Mobp Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Mobp

Symbol: Mobp
Also known as:
RGD ID: 7198499
Expected Size: 217 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389120,175,336 - 120,175,551UniSTSGRCm38
MGSCv379120,084,454 - 120,084,669UniSTSGRCm37
Celera9120,644,133 - 120,644,348UniSTS
Cytogenetic Map9F4UniSTS
Is Marker For: Genes:   Mobp  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGAGCTAGAGTTCAAATCCCC
Reverse Primer GCATGGAGTCCCTGAGTTT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4418889 UniSTS
NCBI Gene 17433 UniSTS
UniGene Mm.486167 UniSTS
UniSTS 528064 UniSTS