Mobp Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Mobp

Symbol: Mobp
Also known as:
RGD ID: 7198497
Expected Size: 297 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389120,149,698 - 120,149,998UniSTSGRCm38
MGSCv379120,058,816 - 120,059,116UniSTSGRCm37
Celera9120,618,513 - 120,618,813UniSTS
Cytogenetic Map9F4UniSTS
Is Marker For: Genes:   Mobp  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGTAGAGCCTCTCCCTATATATTCA
Reverse Primer AGCAGACAAACCTGGGGC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4418895 UniSTS
NCBI Gene 17433 UniSTS
UniSTS 528066 UniSTS