Cryba1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Cryba1

Symbol: Cryba1
Also known as: UniSTS:498739; 
RGD ID: 7197752
Expected Size: 159 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381177,718,840 - 77,719,483UniSTSGRCm38
MGSCv371177,532,342 - 77,532,985UniSTSGRCm37
Celera1185,217,341 - 85,217,984UniSTS
Cytogenetic Map11B-C1UniSTS
Is Marker For: Genes:   Cryba1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGACGCCAGTGGGAAATC
Reverse Primer TGGTGGTCACACTCCAAGATA
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3700263 UniSTS
NCBI Gene 12957 UniSTS
UniSTS 498739 UniSTS