Kitl Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Kitl

Symbol: Kitl
Also known as: UniSTS:498240; 
RGD ID: 7197578
Expected Size: 485 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm3810100,096,733 - 100,097,217UniSTSGRCm38
MGSCv371099,559,367 - 99,559,851UniSTSGRCm37
Celera10102,064,541 - 102,065,025UniSTS
Cytogenetic Map10D1UniSTS
Is Marker For: Genes:   Kitl  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACGTGGACCAGTGGAAGAAC
Reverse Primer AGCAAACTGACATGCACAGC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3690959 UniSTS
NCBI Gene 17311 UniSTS
UniGene Mm.45124 UniSTS
UniSTS 498240 UniSTS