Plod2 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Plod2

Symbol: Plod2
Also known as:
RGD ID: 7197259
Expected Size: 1500 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38992,593,807 - 92,595,352UniSTSGRCm38
MGSCv37992,488,645 - 92,490,190UniSTSGRCm37
Celera992,178,107 - 92,179,652UniSTS
Cytogenetic Map9E3.3UniSTS
cM Map952.0UniSTS
Is Marker For: Genes:   Plod2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCTGAACTTACTGTTAACACT
Reverse Primer GGTTCTCCTCTGGTCCTACTAT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:1929283 UniSTS
NCBI Gene 26432 UniSTS
UniGene Mm.79983 UniSTS
UniSTS 205461 UniSTS