D6Mit70 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D6Mit70

Symbol: D6Mit70
Also known as: MPC637; 
RGD ID: 7197244
Expected Size: 0 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38683,073,182 - 83,073,340UniSTSGRCm38
MGSCv37683,023,176 - 83,023,334UniSTSGRCm37
Celera685,055,792 - 85,055,948UniSTS
cM Map634.78UniSTS
Whitehead Genetic624.0UniSTS
Whitehead_YAC6 UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGGACAGCAACCCATTATTT
Reverse Primer CCAAGCCTGATGACCTGAAT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:705904 UniSTS
UniSTS 130972 UniSTS