Ftcd Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Ftcd

Symbol: Ftcd
Also known as: UniSTS:259611; 
RGD ID: 7196269
Expected Size: 498 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381076,584,175 - 76,584,672UniSTSGRCm38
MGSCv371076,046,920 - 76,047,417UniSTSGRCm37
Celera1077,629,296 - 77,629,793UniSTS
Cytogenetic Map10C1UniSTS
Is Marker For: Genes:   Ftcd  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TAGTCCCCGATAGTGGACCA
Reverse Primer GGCATCAGCATCCACCAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
736511Ftcdformiminotransferase cyclodeaminase107657564876590338Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357740Obsty3_mobesity 3 (mouse)Not determined108359714116355075Mouse
1301386Sysbp1_msystolic blood pressure 1 (mouse)Not determined101023252187565233Mouse
1357825Kidpq2_mkidney weight percentage QTL 2 (mouse)Not determined101282830784243920Mouse
1357656Hrtq3_mheart weight QTL 3 (mouse)Not determined101282830784243920Mouse
1357864Scfpq1_msubcutaneous fat pad percentage QTL 1 (mouse)Not determined101282830784243920Mouse
1357893Lvrq4_mliver weight QTL 4 (mouse)Not determined101282830784243920Mouse
4142380W3q11_mweight 3 weeks QTL 11 (mouse)Not determined1282830784243920Mouse
4141943W6q6_mweight 6 weeks QTL 6 (mouse)Not determined1282830784243920Mouse
4141956Egq7_mearly growth QTL 7 (mouse)Not determined1282830784243920Mouse
4142272W10q5_mweight 10 weeks QTL 5 (mouse)Not determined1282830784243920Mouse
39128215Lwq17_mliver weight QTL 17 (mouse)101282830784243920Mouse
1302067Scc9_mcolon tumor susceptibility 9 (mouse)Not determined1018383585125739363Mouse
27226772Tibl13_mtibia length 13, 10 week (mouse)1019000000129800000Mouse
1558757Eae34_mexperimental allergic encephalomyelitis susceptibility 34 (mouse)Not determined1021532255114381325Mouse
26884403Cvht8_mcranial vault height 8, 16 week (mouse)102300000091200000Mouse
26884426Cvht1_mcranial vault height 1, 5 week (mouse)1024800000121200000Mouse
27095911Pglq15_mpelvic girdle length QTL 15, 16 week (mouse)1039300000129800000Mouse
27226764Tibl19_mtibia length 19, 16 week (mouse)1039300000129800000Mouse
26884411Bzwq8_mbi-zygomatic width QTL 8, 10 week (mouse)1045000000116100000Mouse
26884407Bzwq14_mbi-zygomatic width QTL 14, 16 wee (mouse)1045600000120800000Mouse
4142313Angvq1_mangiogenesis by VEGF QTL 1 (mouse)Not determined4684430782655287Mouse
1302150Bbaa18_mB.burgdorferi-associated arthritis 18 (mouse)Not determined104950223383502378Mouse
4142169Pbwg16_mpostnatal body weight growth 16 (mouse)Not determined105001240884012633Mouse
1300597Skull14_mskull morphology 14 (mouse)Not determined105001240884012633Mouse
10045641Jckm3_mjuvenile cystic kidney modifier 3 (mouse)Not determined105001240884012633Mouse
1301966Lifespan2_mlife span 2 (mouse)Not determined105001244384012618Mouse
1357737Hpcr2_mhepatocarcinogen resistance 2 (mouse)Not determined105001244384012618Mouse
1300882Ath17_matherosclerosis 17 (mouse)Not determined105125566085255809Mouse
1301502Eae17_msusceptibility to experimental allergic encephalomyelitis 17 (mouse)Not determined105125566085255809Mouse
1301380Cia8_mcollagen induced arthritis QTL 8 (mouse)Not determined105161730482655287Mouse
14746991Manh68_mmandible shape 68 (mouse)105244466786444667Mouse
1301787Bsc1_mbrain size control 1 (mouse)Not determined105868113592681262Mouse
26884450Sklq15_mskull length QTL 15, 16 week (mouse)1059500000122500000Mouse
13208560Wght9_mweight 9 (mouse)1060000000121000000Mouse
26884424Zlq9_mzygomatic length QTL 9, 16 week (mouse)1064100000116100000Mouse
1302060El3_mepilepsy 3 (mouse)Not determined106565510499655287Mouse
1300533Aem3_manti-erythrocyte autoantibody modifier 3 (mouse)Not determined106565510499655287Mouse
1301737Insq9_minsulin QTL 9 (mouse)Not determined106565510499655287Mouse
1302035Lmb4_mlupus in MRL and B6 F2 cross (mouse)Not determined106701240892422811Mouse
26884447Sklq9_mskull length QTL 9, 10 week (mouse)1067500000111900000Mouse
26884430Zlq5_mzygomatic length QTL 5, 10 week (mouse)1068000000125000000Mouse
26884405Huml2_mhumerus length 2, 5 week (mouse)1069900000132500000Mouse
11039497Ltpr5a_mLeishmania tropica response 5a (mouse)1073671039107671185Mouse
4142107Obrq12_mobesity resistance QTL 12 (mouse)Not determined7415138482655287Mouse
11353832Pcholq4_mplasma cholesterol QTL 4 (mouse)1074151384125680038Mouse
11353843Gluq1_mblood glucose QTL 1 (mouse)1074151384125680038Mouse
1300975Fembrs3_mfemur breaking strength 3 (mouse)Not determined1075502706109502905Mouse
4142137Femwf3_mfemur work to failure 3 (mouse)Not determined75502706109502905Mouse
1357632Vtbt9_mvertebral trabecular bone trait 9 (mouse)Not determined1075502706109502905Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:2674414 UniSTS
NCBI Gene 14317 UniSTS
UniSTS 259611 UniSTS