Uqcrc1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Uqcrc1

Symbol: Uqcrc1
Also known as:
RGD ID: 7195257
Expected Size: 174 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389108,949,443 - 108,949,617UniSTSGRCm38
MGSCv379108,851,488 - 108,851,662UniSTSGRCm37
Celera9108,507,403 - 108,507,577UniSTS
Cytogenetic Map9F2UniSTS
cM Map957.0UniSTS
Is Marker For: Genes:   Uqcrc1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATAGGGCTTTATTGGGGGTA
Reverse Primer GAGCAGCTCCCAGACTACAA
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:1206418 UniSTS
NCBI Gene 22273 UniSTS
UniGene Mm.335460 UniSTS
  Mm.473802 UniSTS
UniSTS 144735 UniSTS