Tmpo Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Tmpo

Symbol: Tmpo
Also known as:
RGD ID: 7195230
Expected Size: 171 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381091,157,105 - 91,157,275UniSTSGRCm38
MGSCv371090,619,850 - 90,620,020UniSTSGRCm37
Celera1093,151,175 - 93,151,345UniSTS
Cytogenetic Map10C2UniSTS
cM Map1049.0UniSTS
Is Marker For: Genes:   Tmpo  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGCCTAAACCCGTGACTTT
Reverse Primer CACAGAGAAACCGCATCTCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
11425Tmpothymopoietin109114757191181752Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357740Obsty3_mobesity 3 (mouse)Not determined108359714116355075Mouse
1302067Scc9_mcolon tumor susceptibility 9 (mouse)Not determined1018383585125739363Mouse
27226772Tibl13_mtibia length 13, 10 week (mouse)1019000000129800000Mouse
1558757Eae34_mexperimental allergic encephalomyelitis susceptibility 34 (mouse)Not determined1021532255114381325Mouse
26884403Cvht8_mcranial vault height 8, 16 week (mouse)102300000091200000Mouse
26884426Cvht1_mcranial vault height 1, 5 week (mouse)1024800000121200000Mouse
27095911Pglq15_mpelvic girdle length QTL 15, 16 week (mouse)1039300000129800000Mouse
27226764Tibl19_mtibia length 19, 16 week (mouse)1039300000129800000Mouse
26884411Bzwq8_mbi-zygomatic width QTL 8, 10 week (mouse)1045000000116100000Mouse
26884407Bzwq14_mbi-zygomatic width QTL 14, 16 wee (mouse)1045600000120800000Mouse
1301787Bsc1_mbrain size control 1 (mouse)Not determined105868113592681262Mouse
26884450Sklq15_mskull length QTL 15, 16 week (mouse)1059500000122500000Mouse
13208560Wght9_mweight 9 (mouse)1060000000121000000Mouse
26884424Zlq9_mzygomatic length QTL 9, 16 week (mouse)1064100000116100000Mouse
1302060El3_mepilepsy 3 (mouse)Not determined106565510499655287Mouse
1300533Aem3_manti-erythrocyte autoantibody modifier 3 (mouse)Not determined106565510499655287Mouse
1301737Insq9_minsulin QTL 9 (mouse)Not determined106565510499655287Mouse
1302035Lmb4_mlupus in MRL and B6 F2 cross (mouse)Not determined106701240892422811Mouse
26884447Sklq9_mskull length QTL 9, 10 week (mouse)1067500000111900000Mouse
26884430Zlq5_mzygomatic length QTL 5, 10 week (mouse)1068000000125000000Mouse
26884405Huml2_mhumerus length 2, 5 week (mouse)1069900000132500000Mouse
11039497Ltpr5a_mLeishmania tropica response 5a (mouse)1073671039107671185Mouse
11353832Pcholq4_mplasma cholesterol QTL 4 (mouse)1074151384125680038Mouse
11353843Gluq1_mblood glucose QTL 1 (mouse)1074151384125680038Mouse
1300975Fembrs3_mfemur breaking strength 3 (mouse)Not determined1075502706109502905Mouse
4142137Femwf3_mfemur work to failure 3 (mouse)Not determined75502706109502905Mouse
1357632Vtbt9_mvertebral trabecular bone trait 9 (mouse)Not determined1075502706109502905Mouse
11251717Siim1_mstress induced immobility 1 (mouse)1078545406112545406Mouse
14747004Mancz8_mmandible centroid size 8 (mouse)1082242550116242550Mouse
1301165Lith7_mlithogenic gene 7 (mouse)Not determined1082473556116473795Mouse
11059550Lmr32a_mleishmaniasis resistance 32a (mouse)1082473556116473795Mouse
11059551Lmr32b_mleishmaniasis resistance 32b (mouse)1082473556116473795Mouse
11059553Lmr32d_mleishmaniasis resistance 32d (mouse)1082473556116473795Mouse
11059554Lmr32e_mleishmaniasis resistance 32e (mouse)1082473556116473795Mouse
11059555Lmr32f_mleishmaniasis resistance 32f (mouse)1082473556116473795Mouse
10043881Adip24_madiposity 24 (mouse)Not determined1082556941116557090Mouse
12910789Pwgrq19_mpost-weaning growth rate QTL 19 (mouse)108299286692333194Mouse
4141054mwfh_mmodifier of white forlock hypopigmentation (mouse)Not determined83181141117181274Mouse
1357779Tesq3_mtestis weight QTL 3 (mouse)Not determined1084243786122205623Mouse
4141479W10q8_mweight 10 weeks QTL 8 (mouse)Not determined84243786122205623Mouse
4141387Lgaq5_mlate growth adjusted QTL 5 (mouse)Not determined84243786122205623Mouse
4142496W6q8_mweight 6 weeks QTL 8 (mouse)Not determined84243786122205623Mouse
4142365Egq9_mearly growth QTL 9 (mouse)Not determined84243786122205623Mouse
1357594Estoq3_membryo survival total QTL 3 (mouse)Not determined1084243786122205623Mouse
1357622Espq3_membryo survival preimplantation QTL 3 (mouse)Not determined1084243786122205623Mouse
1357638Cia29_mcollagen induced arthritis 29 (mouse)Not determined1085619118118661448Mouse
1300797Sluc22_msusceptibility to lung cancer 22 (mouse)Not determined1086877747120877895Mouse
1301520Uvbi1_mUVB induced immunosuppression 1 (mouse)Not determined1087073224121073368Mouse
1300908Insq4_minsulin QTL 4 (mouse)Not determined1087073224121073368Mouse
1357831Igf1sl2_mIGF-1 serum levels 2 (mouse)Not determined1087858265100100416Mouse
1300921Skl4_mskeletal size (tail length) 4 (mouse)Not determined1088252393122252530Mouse
4142386Tgq20_mtriglyceride QTL 20 (mouse)Not determined89000595123000595Mouse
1301758Fcsa3_mfemoral cross-sectional area 3 (mouse)Not determined1090091790124091893Mouse
11039516Ltpr5_mLeishmania tropica response 5 (mouse)1090671039125739363Mouse
13208554Lgth11_mbody length 11 (mouse)1091000000121000000Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1205148 UniSTS
NCBI Gene 21917 UniSTS
UniGene Mm.159684 UniSTS
UniSTS 144641 UniSTS