Tgfa Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Tgfa

Symbol: Tgfa
Also known as:
RGD ID: 7195211
Expected Size: 143 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38686,270,030 - 86,271,472UniSTSGRCm38
MGSCv37686,220,024 - 86,221,466UniSTSGRCm37
Celera688,203,807 - 88,205,249UniSTS
Cytogenetic Map6D1UniSTS
cM Map635.8UniSTS
Is Marker For: Genes:   Tgfa  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTCTCCATTGTGGCCCTG
Reverse Primer CAAGCAGTCCTTCCCTTCAG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:1204389 UniSTS
NCBI Gene 21802 UniSTS
UniSTS 144608 UniSTS