Psap Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Psap

Symbol: Psap
Also known as:
RGD ID: 7195108
Expected Size: 146 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381060,302,388 - 60,302,533UniSTSGRCm38
GRCm38883,170,749 - 83,170,894UniSTSGRCm38
MGSCv371059,765,136 - 59,765,281UniSTSGRCm37
MGSCv37885,694,648 - 85,694,793UniSTSGRCm37
Celera1061,399,245 - 61,399,390UniSTS
Cytogenetic Map10A3UniSTS
Cytogenetic Map8C3UniSTS
Cytogenetic Map10B4UniSTS
cM Map1035.0UniSTS
Is Marker For: Genes:   Psap   Cdh23   Tbc1d9   Nhsl1   Gm19330  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTCCCACCACCTGTAGCTC
Reverse Primer AACTGCACAGGCTGTCTCCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
11178Psapprosaposin106027762860302600Mouse
1317871Tbc1d9TBC1 domain family, member 988316535283272940Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357740Obsty3_mobesity 3 (mouse)Not determined108359714116355075Mouse
1301386Sysbp1_msystolic blood pressure 1 (mouse)Not determined101023252187565233Mouse
1357825Kidpq2_mkidney weight percentage QTL 2 (mouse)Not determined101282830784243920Mouse
1357656Hrtq3_mheart weight QTL 3 (mouse)Not determined101282830784243920Mouse
1357864Scfpq1_msubcutaneous fat pad percentage QTL 1 (mouse)Not determined101282830784243920Mouse
1357893Lvrq4_mliver weight QTL 4 (mouse)Not determined101282830784243920Mouse
4142380W3q11_mweight 3 weeks QTL 11 (mouse)Not determined1282830784243920Mouse
4141943W6q6_mweight 6 weeks QTL 6 (mouse)Not determined1282830784243920Mouse
4141956Egq7_mearly growth QTL 7 (mouse)Not determined1282830784243920Mouse
4142272W10q5_mweight 10 weeks QTL 5 (mouse)Not determined1282830784243920Mouse
39128215Lwq17_mliver weight QTL 17 (mouse)101282830784243920Mouse
1302067Scc9_mcolon tumor susceptibility 9 (mouse)Not determined1018383585125739363Mouse
27226772Tibl13_mtibia length 13, 10 week (mouse)1019000000129800000Mouse
1558757Eae34_mexperimental allergic encephalomyelitis susceptibility 34 (mouse)Not determined1021532255114381325Mouse
1301003Lmblgq4_mlimb length QTL 4 (mouse)Not determined102171529368255809Mouse
26884403Cvht8_mcranial vault height 8, 16 week (mouse)102300000091200000Mouse
26884426Cvht1_mcranial vault height 1, 5 week (mouse)1024800000121200000Mouse
1300898Cfid_mcystic fibrosis intestinal distress (mouse)Not determined102984430763844387Mouse
10045632Heal16_mwound healing/regeneration 16 (mouse)Not determined103109840365098534Mouse
1357558Bmch4_mbone mechanical trait 4 (mouse)Not determined103170104065701188Mouse
27095920Pglq9_mpelvic girdle length QTL 9, 10 week (mouse)103390000071000000Mouse
27095911Pglq15_mpelvic girdle length QTL 15, 16 week (mouse)1039300000129800000Mouse
27226764Tibl19_mtibia length 19, 16 week (mouse)1039300000129800000Mouse
4141070Ltgq1_mliver triglyceride QTL 1 (mouse)Not determined4140150475401504Mouse
26884411Bzwq8_mbi-zygomatic width QTL 8, 10 week (mouse)1045000000116100000Mouse
26884407Bzwq14_mbi-zygomatic width QTL 14, 16 wee (mouse)1045600000120800000Mouse
26884421Cvht5_mcranial vault height 5, 10 week (mouse)104570000069300000Mouse
26884400Huml5_mhumerus length 5, 16 week (mouse)104640000069400000Mouse
4142313Angvq1_mangiogenesis by VEGF QTL 1 (mouse)Not determined4684430782655287Mouse
4141159Phl2_mprogressive hearing loss 2 (mouse)Not determined104809840370276821Mouse
1302150Bbaa18_mB.burgdorferi-associated arthritis 18 (mouse)Not determined104950223383502378Mouse
4142169Pbwg16_mpostnatal body weight growth 16 (mouse)Not determined105001240884012633Mouse
1300597Skull14_mskull morphology 14 (mouse)Not determined105001240884012633Mouse
10045641Jckm3_mjuvenile cystic kidney modifier 3 (mouse)Not determined105001240884012633Mouse
1301966Lifespan2_mlife span 2 (mouse)Not determined105001244384012618Mouse
1357737Hpcr2_mhepatocarcinogen resistance 2 (mouse)Not determined105001244384012618Mouse
1300882Ath17_matherosclerosis 17 (mouse)Not determined105125566085255809Mouse
1301502Eae17_msusceptibility to experimental allergic encephalomyelitis 17 (mouse)Not determined105125566085255809Mouse
1301380Cia8_mcollagen induced arthritis QTL 8 (mouse)Not determined105161730482655287Mouse
14746991Manh68_mmandible shape 68 (mouse)105244466786444667Mouse
12904011Cfq11_mconditioned fear QTL 11 (mouse)105660406061105062Mouse
1301787Bsc1_mbrain size control 1 (mouse)Not determined105868113592681262Mouse
26884450Sklq15_mskull length QTL 15, 16 week (mouse)1059500000122500000Mouse
13208560Wght9_mweight 9 (mouse)1060000000121000000Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4141395Char2a_mP. chabaudi malaria resistance QTL 2a (mouse)Not determined7113678390202598Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse
1300920Pitm3_mprion incubation time 3 (mouse)Not determined873202495107202598Mouse
27095912Pglq14_mpelvic girdle length QTL 14, 16 week (mouse)873400000126100000Mouse
1558890Lith18_mlithogenic gene 18 (mouse)Not determined875675517109675623Mouse
1357470Obq16_mobesity QTL 16 (mouse)Not determined875685348109685497Mouse
1301808Nhdlq1_mnon-HDL QTL 1 (mouse)Not determined875685348109685497Mouse
1301874Hdlq16_mHDL QTL 16 (mouse)Not determined875685348109685497Mouse
10412234Nhdlq14_mnon-HDL QTL 14 (mouse)Not determined875685348109685497Mouse
1301099Cbm2_mcerebellum weight 2 (mouse)Not determined878518613112518703Mouse
1301581Char2_mP. chabaudi malaria resistance QTL 2 (mouse)Not determined879082178113082403Mouse
12904012Cfq10_mconditioned fear QTL 10 (mouse)88006677589014359Mouse
10755530Wbc2_mwhite blood cell count 2 (mouse)881092664115092664Mouse
10755519Wbc1_mwhite blood cell count 1 (mouse)881619151115619151Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1205052 UniSTS
NCBI Gene 100502703 UniSTS
  19156 UniSTS
  215819 UniSTS
  22295 UniSTS
  71310 UniSTS
UniGene Mm.277498 UniSTS
  Mm.297971 UniSTS
  Mm.440103 UniSTS
  Mm.446546 UniSTS
  Mm.471805 UniSTS
  Mm.474658 UniSTS
UniSTS 144271 UniSTS