Prkaca Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: Prkaca

Symbol:

Prkaca

Also known as:

Pkaca;

RGD ID:

7195073

Expected Size:

182 (bp)

Position

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	8	83,996,024 - 83,996,207	UniSTS	GRCm38
GRCm38	X	161,483,952 - 161,484,116	UniSTS	GRCm38
MGSCv37	X	157,921,884 - 157,922,048	UniSTS	GRCm37
MGSCv37	8	86,519,923 - 86,520,106	UniSTS	GRCm37
Celera	8	88,289,224 - 88,289,407	UniSTS
Celera	X	144,721,559 - 144,721,723	UniSTS
Cytogenetic Map	8	C3	UniSTS
cM Map	8		UniSTS

Is Marker For:

Genes: Prkaca Samd1

Annotation

References - curated


1.	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CTCGCCCTGAGCTGCTAG
Reverse Primer	AAGCACAATCAGACTTGGGG

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1552640	Prkaca	protein kinase, cAMP dependent, catalytic, alpha	8	83972978	83996444	Mouse
7243093	Prkaca-ps1	protein kinase, cAMP dependent, catalytic, alpha pseudogene 1	X	161483546	161486510	Mouse

Nucleotide Sequences


RefSeq Transcripts	NM_001277898	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_008854	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC156028	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL672266	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC003238	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC054834	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	GL592314	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	M12303	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	M19960	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4140967	Bmd39_m	bone mineral density 39 (mouse)			Not determined		8	32016544	117238700	Mouse
1558875	Eae31_m	experimental allergic encephalomyelitis susceptibility 31 (mouse)			Not determined		8	34642776	114837007	Mouse
1301013	Capsq4_m	capsaicin sensitivity related QTL 4 (mouse)			Not determined		8	36163000	92728652	Mouse
27226754	Femd6_m	femur midshaft diameter 6, 10 week (mouse)					8	37400000	109600000	Mouse
12904744	Carcdq1_m	cardiac collagen deposition QTL 1 (mouse)					8	39709256	94689598	Mouse
14746987	Manh64_m	mandible shape 64 (mouse)					8	50053306	84053306	Mouse
14747005	Mancz7_m	mandible centroid size 7 (mouse)					8	50053306	84053306	Mouse
14700686	Civq3_m	cerebral infarct volume QTL 3 (mouse)					8	51882191	85882191	Mouse
1301506	Aevm1_m	autoimmune extremity vasculitis in MRL mice 1 (mouse)			Not determined		8	54287817	88287993	Mouse
1301952	Im3_m	immunoregulatory 3 (mouse)			Not determined		8	54706614	88706763	Mouse
10412287	Carg3_m	Candida albicans resistance gene 3 (mouse)			Not determined		8	55545028	89545028	Mouse
11353828	Gf7_m	gonadal fat pad weight 7 (mouse)					8	58201479	92201479	Mouse
10043975	Obq31_m	obesity QTL 31 (mouse)			Not determined		8	58409776	92409776	Mouse
1301688	Orch6_m	autoimmune orchitis resistance 6 (mouse)			Not determined		8	60786850	94786976	Mouse
4141285	Tgq18_m	triglyceride QTL 18 (mouse)			Not determined			63460107	97460107	Mouse
4141797	Skmw16_m	skeletal muscle weight 16 (mouse)			Not determined		8	63939547	97939696	Mouse
1357787	Vtbt5_m	vertebral trabecular bone trait 5 (mouse)			Not determined		8	65357768	99357920	Mouse
10043992	Hbnr11_m	Heligmosomoides bakeri nematode resistance 11 (mouse)			Not determined		8	65600207	99600347	Mouse
1301767	Fcsa2_m	femoral cross-sectional area 2 (mouse)			Not determined		8	70305375	104305495	Mouse
4142283	Imraq2_m	immune response to AAV2 QTL 2 (mouse)			Not determined		8	70305375	104305495	Mouse
1558780	Idd22_m	insulin dependent diabetes susceptibility 22 (mouse)			Not determined		8	71102903	105103009	Mouse
4141395	Char2a_m	P. chabaudi malaria resistance QTL 2a (mouse)			Not determined			71136783	90202598	Mouse
4142023	W3q5_m	weight 3 weeks QTL 5 (mouse)			Not determined			71287817	123895615	Mouse
1357708	Orq1_m	ovulation rate QTL 1 (mouse)			Not determined		8	71287817	123895615	Mouse
1301872	Cd4ts3_m	CD4 T cell subset 3 (mouse)			Not determined		8	71396181	105396393	Mouse
1300920	Pitm3_m	prion incubation time 3 (mouse)			Not determined		8	73202495	107202598	Mouse
27095912	Pglq14_m	pelvic girdle length QTL 14, 16 week (mouse)					8	73400000	126100000	Mouse
1558890	Lith18_m	lithogenic gene 18 (mouse)			Not determined		8	75675517	109675623	Mouse
1357470	Obq16_m	obesity QTL 16 (mouse)			Not determined		8	75685348	109685497	Mouse
1301808	Nhdlq1_m	non-HDL QTL 1 (mouse)			Not determined		8	75685348	109685497	Mouse
1301874	Hdlq16_m	HDL QTL 16 (mouse)			Not determined		8	75685348	109685497	Mouse
10412234	Nhdlq14_m	non-HDL QTL 14 (mouse)			Not determined		8	75685348	109685497	Mouse
1301099	Cbm2_m	cerebellum weight 2 (mouse)			Not determined		8	78518613	112518703	Mouse
1301581	Char2_m	P. chabaudi malaria resistance QTL 2 (mouse)			Not determined		8	79082178	113082403	Mouse
12904012	Cfq10_m	conditioned fear QTL 10 (mouse)					8	80066775	89014359	Mouse
10755530	Wbc2_m	white blood cell count 2 (mouse)					8	81092664	115092664	Mouse
10755519	Wbc1_m	white blood cell count 1 (mouse)					8	81619151	115619151	Mouse
1302000	Pgia25_m	proteoglycan induced arthritis 2 (mouse)			Not determined		X	145691384	171031299	Mouse
1357619	Obsty5_m	obesity 5 (mouse)			Not determined		X	161429897	165366288	Mouse
1357823	Spha3_m	sperm head anomaly 3 (mouse)			Not determined		X	103012242	163975945	Mouse
1558900	Bw3_m	body weight QTL 3 (mouse)			Not determined		X	134639291	166515599	Mouse
10401118	Pgia39_m	proteoglycan induced arthritis 39 (mouse)			Not determined		X	145691384	171031299	Mouse

Additional Information

External Database Links

Database	Acc Id	Source(s)
MGD	MGI:1205543	UniSTS
NCBI Gene	18747	UniSTS
	666704	UniSTS
UniGene	Mm.19111	UniSTS
	Mm.410287	UniSTS
	Mm.490407	UniSTS
UniSTS	144189	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description: