Cck Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Cck

Symbol: Cck
Also known as:
RGD ID: 7194556
Expected Size: 179 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389121,489,912 - 121,490,093UniSTSGRCm38
MGSCv379121,399,030 - 121,399,211UniSTSGRCm37
Celera9121,960,611 - 121,960,792UniSTS
Cytogenetic Map9F4UniSTS
cM Map971.0UniSTS
Is Marker For: Genes:   Cck  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCGAGGACTACGAATACCCA
Reverse Primer AGGCTGAGATGTGGCTGC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:1204027 UniSTS
NCBI Gene 12424 UniSTS
UniGene Mm.2619 UniSTS
UniSTS 141251 UniSTS