Pccb Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Pccb

Symbol: Pccb
Also known as:
RGD ID: 7194459
Expected Size: 177 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389101,077,220 - 101,077,396UniSTSGRCm38
MGSCv379100,980,944 - 100,981,120UniSTSGRCm37
Celera9100,617,137 - 100,617,313UniSTS
Cytogenetic Map9E4UniSTS
cM Map9 UniSTS
Is Marker For: Genes:   Pccb   Msl2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGTTTGAAGTCAGCCTA
Reverse Primer CGGTGCTTGGAACTTGAAAACC
 

Region

Nucleotide Sequences
GenBank Nucleotide AC242673 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL589690 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
MGD MGI:1932916 UniSTS
NCBI Gene 66904 UniSTS
  77853 UniSTS
UniGene Mm.326206 UniSTS
UniSTS 233970 UniSTS