Emx1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Emx1

Symbol: Emx1
Also known as:
RGD ID: 7194262
Expected Size: 182 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38685,194,040 - 85,194,221UniSTSGRCm38
MGSCv37685,144,034 - 85,144,215UniSTSGRCm37
Celera687,165,631 - 87,165,812UniSTS
Cytogenetic Map6C3UniSTS
cM Map635.5UniSTS
Is Marker For: Genes:   Emx1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGCGACGTTCCCCAGGACGGGCTGC
Reverse Primer TGCGTCTCGGAGAGGCTGAGGCTGC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:2136383 UniSTS
NCBI Gene 13796 UniSTS
UniSTS 226151 UniSTS