Cyp26b1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Cyp26b1

Symbol: Cyp26b1
Also known as: UniSTS:464663; 
RGD ID: 7194117
Expected Size: 145 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38684,584,266 - 84,584,381UniSTSGRCm38
MGSCv37684,534,260 - 84,534,375UniSTSGRCm37
Celera686,565,295 - 86,565,410UniSTS
Cytogenetic Map6C3UniSTS
Is Marker For: Genes:   Cyp26b1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGAATGTGCGCAAGATCCTACT
Reverse Primer TGGATGTCGCCAATGGAATT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3510935 UniSTS
NCBI Gene 232174 UniSTS
UniSTS 464663 UniSTS