Ucp1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Ucp1

Symbol: Ucp1
Also known as: UniSTS:461937; 
RGD ID: 7194007
Expected Size: 76 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38883,293,887 - 83,293,962UniSTSGRCm38
MGSCv37885,817,786 - 85,817,861UniSTSGRCm37
Celera887,568,254 - 87,568,329UniSTS
Cytogenetic Map8C2UniSTS
Is Marker For: Genes:   Ucp1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACACCTGCCTCTCTCGGAAA
Reverse Primer TAGGCTGCCCAATGAACACT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3050128 UniSTS
NCBI Gene 22227 UniSTS
UniGene Mm.4177 UniSTS
UniSTS 461937 UniSTS