Nr2f6 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Nr2f6

Symbol: Nr2f6
Also known as:
RGD ID: 7193758
Expected Size: 522 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38871,374,168 - 71,374,689UniSTSGRCm38
MGSCv37873,898,067 - 73,898,588UniSTSGRCm37
Celera873,898,838 - 73,899,359UniSTS
Cytogenetic Map8B3.3UniSTS
cM Map833.5UniSTS
Is Marker For: Genes:   Nr2f6  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCGAGTATGTGCGTGCCCAG
Reverse Primer TGGTGCCCTCCGTGGACCATG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3766825 UniSTS
NCBI Gene 13864 UniSTS
UniGene Mm.28989 UniSTS
UniSTS 507939 UniSTS