AA893014 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AA893014

Symbol: AA893014
Also known as:
RGD ID: 7193084
Expected Size: 101 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01048,210,569 - 48,210,669NCBIRnor6.0
Rnor_5.01048,001,851 - 48,001,951UniSTSRnor5.0
RGSC_v3.41048,088,417 - 48,088,517UniSTSRGSC3.4
Celera1045,855,780 - 45,855,880UniSTS
Cytogenetic Map10q23UniSTS
RH 3.4 Map10539.2UniSTS
Is Marker For: Genes:   Akap10  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACTGTGTGCGTCATGAGTTCCT
Reverse Primer TGGCTTCCTTAAAGCTTACCCA
 

Region

Nucleotide Sequences


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1076442166221621Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10587753664401490Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10622909575983805Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10642907599492409Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10752145052521450Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109841807108540162Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101263951357639513Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101482789492423564Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014827894107857673Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014827894110992275Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101537547462469074Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101646873661468736Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101824639453637634Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101940281464402814Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)1020170031102897474Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102152390683549467Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)12152390690312401Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102152390690312401Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102170776664648311Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102290149793886300Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102386101566539843Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1023861015112626471Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102723753064648311Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)1027237530101482600Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1027237530102427718Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102878928073789280Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)103002135454057745Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103098380575983805Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103191939778343192Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103317903078179030Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103334319278343192Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103513942480139424Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)103618592982675365Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)103618592995845311Rat
1354614Hpcl1Hepatic cholesterol level QTL 13.3liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)103658437353645194Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103658437366539843Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103658456066015527Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)104051404485514044Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)104051404485514044Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1041260363106105607Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104318865981042642Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1043289657108540162Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104370495588704955Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104659302198939209Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104684834691848346Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104684834691848346Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104684834691848346Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360540 UniSTS
UniGene Rn.160358 UniSTS
UniSTS 261295 UniSTS