D19Arb7 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19Arb7

Symbol: D19Arb7
Also known as: oxsts7749; 
RGD ID: 61309
Expected Size: 280 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21910,827,691 - 10,827,970 (+)MAPPER
Rnor_6.01911,303,651 - 11,303,927NCBIRnor6.0
Celera1910,713,649 - 10,713,920UniSTS
Cytogenetic Map19p12UniSTS
Is Marker For: QTLs:   Cia14  
Genes:   Mt1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CAGCTGCCCGTATTGGTTTTGG
Reverse Primer CTTTAGCCATCGGCTCTACTCC
 

Region

Nucleotide Sequences
GenBank Nucleotide M11794 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7411590Foco7Food consumption QTL 76.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)19124933090Rat
10054132Srcrt9Stress Responsive Cort QTL 92.870.0017blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19127635288Rat
631678Cm9Cardiac mass QTL 94.270.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)19129558305Rat
631681Cm12Cardiac mass QTL 123.330.00053heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)19129558305Rat
1549847Bss8Bone structure and strength QTL 84lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)19132379055Rat
9590298Uminl5Urine mineral level QTL 53.590.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)19138221845Rat
9590250Scort11Serum corticosterone level QTL 1123.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19138221845Rat
9590090Insglur8Insulin/glucose ratio QTL 810.810.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)19138221845Rat
8552935Pigfal10Plasma insulin-like growth factor 1 level QTL 105.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)19138221845Rat
2317848Alcrsp21Alcohol response QTL 211.8999999761581420.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)19104464846044648Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19195770746957707Rat
7247442Uae39Urinary albumin excretion QTL 39urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19243296347217667Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19243296362275575Rat
9589102Slep13Serum leptin concentration QTL 134.630.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)19370183548701835Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)19370183548701835Rat
724565Tcas5Tongue tumor susceptibility QTL 510.04tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)19500757143907843Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19650676160220581Rat
724518Uae19Urinary albumin excretion QTL 195.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19807254547318201Rat
631840Niddm38Non-insulin dependent diabetes mellitus QTL 383.86blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)191073992926201726Rat
61423Cia14Collagen induced arthritis QTL 143joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)191130392747879277Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 24567 UniSTS
  326431 UniSTS
UniSTS 240551 UniSTS