D2Uwm15 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Uwm15

Symbol: D2Uwm15
Previously known as: UW306; oxsts8363; 
RGD ID: 61291
Expected Size: 139 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2223,319,296 - 23,319,447 (+)MAPPERmRatBN7.2
Rnor_6.0221,657,309 - 21,657,459NCBIRnor6.0
Rnor_5.0240,862,862 - 40,863,012UniSTSRnor5.0
RGSC_v3.4222,318,697 - 22,318,848RGDRGSC3.4
RGSC_v3.4222,318,698 - 22,318,848UniSTSRGSC3.4
RGSC_v3.1222,239,066 - 22,239,217RGD
Celera219,411,090 - 19,411,268UniSTS
Cytogenetic Map2q12-q14UniSTS
Is Marker For: QTLs:   Mcs1  
Genes:   Rasgrf2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Electronic Submission of SSLP Data Sets Gould M, Shepel L, Feb.(9) 2001. University of Wisconsin Medical School, McArdle Cancer Research Center
3. Genetic identification of Mcs-1, a rat mammary carcinoma suppressor gene. Hsu LC, etal., Cancer Res 1994 May 15;54(10):2765-70
4. UniSTS Pipeline RGD automated pipelines
5. Genetic identification of multiple loci that control breast cancer susceptibility in the rat Shepel LA, etal., Genetics 1998 May;149(1):289-99

Strains and Sequence

Sequence
 
Forward Primer TACCTTTATGTAGTCATTATTT
Reverse Primer CCAACATAATAAGAACTCTAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
69413Rasgrf2RAS protein-specific guanine nucleotide-releasing factor 222311361323361537Rat

Nucleotide Sequences
GenBank Nucleotide JH613238 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
61368Mcs1Mammary carcinoma susceptibility QTL 14.4mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777223319447Rat
1600379Mcs18Mammary carcinoma susceptibility QTL 182.6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777242804738Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
1578664Bmd9Bone mineral QTL density 95femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)21185206249003364Rat
731184Mamtr4Mammary tumor resistance QTL 40.0003mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)21649174061491740Rat
1357990Ael1Aortic elastin QTL 13.10.00091aorta elastin amount (VT:0003905)aortic elastin21907682564076825Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
2300168Bmd47Bone mineral density QTL 476.60.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)22066244865662448Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 114513 UniSTS
  326383 UniSTS
UniSTS 240114 UniSTS