DXGot58 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: DXGot58

Symbol: DXGot58
Previously known as: OT77.40; oxsts2824; 
RGD ID: 60692
Expected Size: 133 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X126,421,699 - 126,421,832 (+)MAPPERmRatBN7.2
Rnor_6.0X134,067,171 - 134,067,303NCBIRnor6.0
Rnor_5.0X134,143,570 - 134,143,702UniSTSRnor5.0
RGSC_v3.4X133,592,300 - 133,592,432RGDRGSC3.4
RGSC_v3.4X133,592,301 - 133,592,433UniSTSRGSC3.4
RGSC_v3.1X133,665,733 - 133,665,865RGD
CeleraX125,391,611 - 125,391,743UniSTS
RH 3.4 MapX879.3RGD
RH 3.4 MapX879.3UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAACCCTATGTGGTCAACCC
Reverse Primer CGATCCTCTCTTGAATTCATTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU024973 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
1598872Memor14Memory QTL 144.5exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X93956491138956491Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX100567703150256146Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X103312877148312877Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X103312877148312877Rat
738029Stresp2Stress response QTL 23.40.0004stress-related behavior trait (VT:0010451)defensive burying - approachX112934952138400867Rat
5685004Bss104Bone structure and strength QTL 1043.9tibia area (VT:1000281)tibia area measurement (CMO:0001382)X113805422126975220Rat
10059603Bw174Body weight QTL 1743.40.025body mass (VT:0001259)body weight (CMO:0000012)X113937816152453651Rat


Additional Information

Database Acc Id Source(s)
UniSTS 115721 UniSTS