Marker: DXGot36 |
Symbol: |
DXGot36 |
Previously known as: |
OT38.26; oxsts2805;
|
RGD ID: |
60681 |
Expected Size: |
238 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | X | 45,220,841 - 45,221,079 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | X | 48,586,257 - 48,586,494 | NCBI | Rnor6.0 | Rnor_5.0 | X | 48,790,007 - 48,790,244 | UniSTS | Rnor5.0 | RGSC_v3.4 | X | 67,314,551 - 67,314,789 | RGD | RGSC3.4 | RGSC_v3.4 | X | 67,314,552 - 67,314,789 | UniSTS | RGSC3.4 | RGSC_v3.1 | X | 67,368,021 - 67,368,258 | RGD | | Celera | X | 45,869,602 - 45,869,839 | UniSTS | | RH 3.4 Map | X | 603.01 | RGD | | RH 3.4 Map | X | 603.01 | UniSTS | |
|
Annotation
Strains and Sequence
Sequence
|
Forward Primer |
GCTCAGTTTTACATCCCTTGG |
Reverse Primer |
ATCATGGATGCATGTGTGC |
|
Region
QTLs in Region (mRatBN7.2)
1298071 | Edpm12 | Estrogen-dependent pituitary mass QTL 12 | 3.2 | | pituitary gland mass (VT:0010496) | pituitary gland wet weight (CMO:0000853) | X | 2927898 | 47927898 | Rat | 10755455 | Coatc13 | Coat color QTL 13 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 4406000 | 49406000 | Rat | 631666 | Iddm5 | Insulin dependent diabetes mellitus QTL 5 | | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 4494549 | 49494549 | Rat | 61430 | Cia18 | Collagen induced arthritis QTL 18 | 3.1 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | X | 14843113 | 120568734 | Rat | 71116 | Niddm16 | Non-insulin dependent diabetes mellitus QTL 16 | 7.81 | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 15297802 | 60297802 | Rat | 1598837 | Memor13 | Memory QTL 13 | 3.2 | | exploratory behavior trait (VT:0010471) | difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) | X | 41052407 | 146860749 | Rat | 738035 | Stresp1 | Stress response QTL 1 | 4.96 | 0.000011 | stress-related behavior trait (VT:0010451) | defensive burying - coping | X | 41304447 | 112935181 | Rat | |
Additional Information
External Database Links
Database |
Acc Id |
Source(s) |
UniSTS |
113051 |
UniSTS |
|
|