DXGot36 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXGot36

Symbol: DXGot36
Previously known as: OT38.26; oxsts2805; 
RGD ID: 60681
Expected Size: 238 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X45,220,841 - 45,221,079 (+)MAPPERmRatBN7.2
Rnor_6.0X48,586,257 - 48,586,494NCBIRnor6.0
Rnor_5.0X48,790,007 - 48,790,244UniSTSRnor5.0
RGSC_v3.4X67,314,551 - 67,314,789RGDRGSC3.4
RGSC_v3.4X67,314,552 - 67,314,789UniSTSRGSC3.4
RGSC_v3.1X67,368,021 - 67,368,258RGD
CeleraX45,869,602 - 45,869,839UniSTS
RH 3.4 MapX603.01RGD
RH 3.4 MapX603.01UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTCAGTTTTACATCCCTTGG
Reverse Primer ATCATGGATGCATGTGTGC
 

Region

Nucleotide Sequences
GenBank Nucleotide AU027699 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X292789847927898Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7440600049406000Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X449454949494549Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
71116Niddm16Non-insulin dependent diabetes mellitus QTL 167.81blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X1529780260297802Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat


Additional Information

Database Acc Id Source(s)
UniSTS 113051 UniSTS