D6Got169 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D6Got169

Symbol: D6Got169
Previously known as: oxsts2272; OT59.08; 
RGD ID: 60517
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26118,638,680 - 118,638,868 (+)MAPPERmRatBN7.2
Rnor_6.06123,372,643 - 123,372,830NCBIRnor6.0
Rnor_5.06132,601,392 - 132,601,579UniSTSRnor5.0
RGSC_v3.46123,557,337 - 123,557,525RGDRGSC3.4
RGSC_v3.46123,557,338 - 123,557,525UniSTSRGSC3.4
RGSC_v3.16123,561,084 - 123,561,272RGD
Celera6116,192,723 - 116,192,900UniSTS
Cytogenetic Map6q32UniSTS
Is Marker For: Genes:   Foxn3  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGCATGGGTGGCTGATT
Reverse Primer CTCACACACCTGCACACACAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305711Foxn3forkhead box N36118462018118842442Rat

Nucleotide Sequences
GenBank Nucleotide AU025514 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6104085867128713626Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6116506292130245370Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
1300076Glom8Glomerulus QTL 879e-09kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 314374 UniSTS