D2Got178 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D2Got178

Symbol: D2Got178
Previously known as: oxsts1729; OT24.24; 
RGD ID: 60311
Expected Size: 154 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22245,307,252 - 245,307,407 (+)MAPPERmRatBN7.2
Rnor_6.02262,596,835 - 262,596,987NCBIRnor6.0
Rnor_5.02281,267,325 - 281,267,477UniSTSRnor5.0
RGSC_v3.42254,331,953 - 254,332,106RGDRGSC3.4
RGSC_v3.42254,331,954 - 254,332,106UniSTSRGSC3.4
RGSC_v3.12254,346,561 - 254,346,713RGD
Celera2237,140,152 - 237,140,302UniSTS
RH 3.4 Map21629.7RGD
RH 3.4 Map21629.7UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACTGTGGGTAAACTAGAACAGGAAT
Reverse Primer CTGTCCCCCCATATAGAAAGC
 

Region

Nucleotide Sequences
GenBank Nucleotide AU028433 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631563Hcuc3Hepatic copper content QTL 33.87liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)2229059610249053267Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2211744537249053267Rat
2293833Kiddil8Kidney dilation QTL 82.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2200990457245990457Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2214226044247136170Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2211744537249053267Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2211744537249053267Rat
7411555Bw132Body weight QTL 1320.001body mass (VT:0001259)body weight gain (CMO:0000420)2223389739249053267Rat
9587428Epfw6Epididymal fat weight QTL 67.470.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)2223389739249053267Rat
2293844Kiddil7Kidney dilation QTL 73.5kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2211744537249053267Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2211744537249053267Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2193452645245889826Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
2317885Alcrsp28Alcohol response QTL 282.10.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2212828222249053267Rat


Additional Information