D1Got229 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Got229

Symbol: D1Got229
Also known as: OT23.07; oxsts109; 
RGD ID: 60224
Expected Size: 253 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01246,554,654 - 246,554,888NCBIRnor6.0
Rnor_5.01253,795,262 - 253,795,496UniSTSRnor5.0
RGSC_v3.41232,060,231 - 232,060,481RGDRGSC3.4
RGSC_v3.41232,060,232 - 232,060,481UniSTSRGSC3.4
RGSC_v3.11232,224,255 - 232,224,504RGD
Celera1223,307,153 - 223,307,402UniSTS
RH 3.4 Map11614.4UniSTS
RH 3.4 Map11614.4RGD
Cytogenetic Map1q52UniSTS
Is Marker For: Genes:   Glis3  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CCCTACACCCAGAGAAGTTTGA
Reverse Primer AGCAATCATCAGCAGTGAACTTCT
 

Region

Nucleotide Sequences
GenBank Nucleotide AU027884 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 680671 UniSTS
UniSTS 112870 UniSTS