Hoxa10 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Hoxa10

Symbol: Hoxa10
Also known as:
RGD ID: 5507674
Expected Size: 1537 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0482,201,562 - 82,203,098NCBIRnor6.0
Rnor_6.0482,287,357 - 82,288,893NCBIRnor6.0
Rnor_5.04146,954,188 - 146,955,724UniSTSRnor5.0
Rnor_5.04146,868,393 - 146,869,929UniSTSRnor5.0
RGSC_v3.4480,532,885 - 80,534,421UniSTSRGSC3.4
Celera476,223,627 - 76,225,163UniSTS
Is Marker For: Genes:   LOC100913071   LOC100912608   LOC100911668   LOC100909714  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGGCCTCTGGCTCGACCGA
Reverse Primer GTCCGTGAGGTGGACGCTAC
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 100909714 UniSTS
  100911668 UniSTS
  100912608 UniSTS
  100913071 UniSTS
UniSTS 143362 UniSTS