RH17231 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH17231

Symbol: RH17231
Also known as:
RGD ID: 5506457
Expected Size: 109 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21479,956,606 - 79,956,715 (+)MAPPERmRatBN7.2
Rnor_6.01485,313,347 - 85,313,455NCBIRnor6.0
Rnor_5.01485,990,968 - 85,991,076UniSTSRnor5.0
RGSC_v3.41485,721,521 - 85,721,629UniSTSRGSC3.4
Celera1478,847,562 - 78,847,670UniSTS
Cytogenetic Map14q21UniSTS
Is Marker For: Genes:   Rasl10a   Gas2l1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACTTTACTGTCAGAGGCTC
Reverse Primer GAGCGTTGCTATTTAATTAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1311206Gas2l1growth arrest-specific 2 like 1147995170279961830Rat

Nucleotide Sequences
GenBank Nucleotide G20774 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)146875779683368335Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
631213Bw60Body weight QTL604.51retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)147995092195876975Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360973 UniSTS
  364190 UniSTS
UniSTS 10947 UniSTS