UniSTS:488584 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:488584

Symbol: UniSTS:488584
Also known as:
RGD ID: 5505668
Expected Size: 387 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01744,747,802 - 44,748,188NCBIRnor6.0
Rnor_6.01743,689,553 - 43,689,953NCBIRnor6.0
Rnor_5.01758,718,819 - 58,719,205UniSTSRnor5.0
Rnor_5.01745,543,178 - 45,543,578UniSTSRnor5.0
RGSC_v3.41750,342,360 - 50,342,746UniSTSRGSC3.4
RGSC_v3.41748,448,932 - 48,449,332UniSTSRGSC3.4
Celera1753,752,960 - 53,753,346UniSTS
Celera1741,074,117 - 41,074,517UniSTS
Cytogenetic Map17q11UniSTS
Cytogenetic Map17p11UniSTS
Is Marker For: Genes:   Hist1h2ao   Hist1h2bl   LOC680447   LOC682505   LOC100360053   H2bc9  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGTCTGGACGCGGTAAGCAGGGCGG
Reverse Primer TCACTTGGCCTTGTGGTGGCTCTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2322892LOC100360053histone cluster 1, H2ae-like174368952243690004Rat
2776H1f4H1.4 linker histone, cluster member174373446143735120Rat
7512935LOC102552937KH homology domain-containing protein 1-like174373735243740699Rat
2320230LOC100364835histone cluster 1, H2bd-like174376465443765101Rat
7529415LOC102551184histone H4-like174377019843821579Rat
1586732H3c13H3 clustered histone 13174377601843776779Rat
1586722LOC684773similar to histone 2a174377735343777827Rat
9275168LOC103694090histone H2B type 1-H-like174377805443778468Rat
1586699LOC684797similar to Histone H2B 291B174377848143778990Rat
1309078Hist1h2anhistone cluster 1, H2an174377917443779775Rat
6498914LOC100910366uncharacterized LOC100910366174379152343802099Rat
1585577LOC684819similar to H3 histone, family 2 isoform 2174379439743795493Rat
1585568H4f3H1.3 linker histone, cluster member174379771143798450Rat
1585555LOC684841similar to CG31613-PA174380692243807563Rat
2319827LOC100365043histone cluster 1, H2bd-like174380861743817817Rat
1311554Hist1h2ail1histone cluster 1 H2a family member I like 1174381477343815183Rat
6485891LOC100912677histone H2A type 1-F-like174381668643817127Rat
621439Hist1h2bghistone cluster 1, H2bg174381731643817717Rat
1596791H4f16H4 histone 16174382112243821587Rat
11412806LOC108348560uncharacterized LOC108348560174382163643826662Rat
11438638Trnam-cau4transfer RNA methionine (anticodon CAU) 4174382226743822338Rat
11474935Trnar-ucg3transfer RNA arginine (anticodon UCG) 3174382650243826574Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)174383163543831716Rat
11427922Trnas-gcu8transfer RNA serine (anticodon GCU) 8174383163543831716Rat
11462764Trnaq-uug2transfer RNA glutamine (anticodon UUG) 2174383381143833882Rat
11430337Trnaq-uug3transfer RNA glutamine (anticodon UUG) 3174383434543834416Rat
11359056Trnas-uga2transfer RNA serine (anticodon UGA) 2174383540743835488Rat
11416553Trnam-cau5transfer RNA methionine (anticodon CAU) 5174383586943835940Rat
9214914LOC103694091uncharacterized LOC103694091174383719743860342Rat
11441119Trnaw-cca7transfer RNA tryptophan (anticodon CCA) 7174384558343845654Rat
11418896Trnar-ucg4transfer RNA arginine (anticodon UCG) 4174384787243847944Rat
11450768Trnas-aga6transfer RNA serine (anticodon AGA) 6174385126943851350Rat
11358050Trnar-acg4transfer RNA arginine (anticodon ACG) 4174385171443851786Rat
11451236Trnaw-cca8transfer RNA tryptophan (anticodon CCA) 8174385372743853798Rat
1306973Btn2a2butyrophilin, subfamily 2, member A2174386724343878734Rat
1306984Btn1a1butyrophilin, subfamily 1, member A1174389915543909042Rat
11451237Trnae-uuc10transfer RNA glutamic acid (anticodon UUC) 10174390347943903550Rat
9346839LOC103694092uncharacterized LOC103694092174391020043923939Rat
6576114Trnat-agutransfer RNA threonine (anticodon AGU)174391932243919395Rat
11422105Trnat-agu5transfer RNA threonine (anticodon AGU) 5174391932243919395Rat
11454070Trnar-acg5transfer RNA arginine (anticodon ACG) 5174392320743923279Rat
11476617Trnav-cac4transfer RNA valine (anticodon CAC) 4174392386443923936Rat
11490736Trnaa-cgc2transfer RNA alanine (anticodon CGC) 2174393099543931066Rat
11412596Trnai-aau7transfer RNA isoleucine (anticodon AAU) 7174393158243931655Rat
11388337Trnap-agg17transfer RNA proline (anticodon AGG) 17174393317643933247Rat
11455261Trnaa-agc10transfer RNA alanine (anticodon AGC) 10174393852543938597Rat
1310785Abt1activator of basal transcription 1174394611843948224Rat
11458077LOC108353148uncharacterized LOC108353148174395482343964707Rat
11481973Trnav-aac6transfer RNA valine (anticodon AAC) 6174396178743961859Rat
11366550Trnaa-agc11transfer RNA alanine (anticodon AGC) 11174396206543962137Rat
11395923Trnav-cac5transfer RNA valine (anticodon CAC) 5174396316543963237Rat
11478251LOC10834856140S ribosomal protein S29 pseudogene174397503943975309Rat
11386218LOC108348562uncharacterized LOC108348562174399091344031268Rat
1594230Zfp322azinc finger protein 322a174402503644040900Rat
11472361Trnam-cau6transfer RNA methionine (anticodon CAU) 6174405890444058976Rat
11472030Trnai-aau8transfer RNA isoleucine (anticodon AAU) 8174406286144062934Rat
11449887Trnaa-agc12transfer RNA alanine (anticodon AGC) 12174406930644069378Rat
11483266Trnav-cac6transfer RNA valine (anticodon CAC) 6174406957244069644Rat
11432611Trnav-cac7transfer RNA valine (anticodon CAC) 7174407599344076065Rat
7562567LOC102556841uncharacterized LOC102556841174407658744077357Rat
11466408LOC108353149uncharacterized LOC108353149174422941344233626Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)174435734044357421Rat
11403004Trnas-gcu9transfer RNA serine (anticodon GCU) 9174435734044357421Rat
11416854LOC108353150uncharacterized LOC108353150174438166244385185Rat
1561897RGD1561897similar to Serine/threonine-protein kinase Kist (Kinase interacting with stathmin)174441846344420729Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)174449328144493362Rat
11358645Trnas-gcu10transfer RNA serine (anticodon GCU) 10174449328144493362Rat
2325039H2bc9H2B clustered histone 9174451981544520269Rat
1597155Hist1h2achistone cluster 1 H2A family member C174452048444521142Rat
620814Hist1h4bhistone cluster 1 H4 family member B174452214444526587Rat
1593016H2bc12H2B clustered histone 12174452742144527801Rat
1593006H2ac12H2A clustered histone 12174452799044528557Rat
6576114Trnat-agutransfer RNA threonine (anticodon AGU)174453466944534742Rat
11470760Trnat-agu6transfer RNA threonine (anticodon AGU) 6174453466944534742Rat
11374956Trnai-aau9transfer RNA isoleucine (anticodon AAU) 9174453565744535730Rat
7606205LOC102556078uncharacterized LOC102556078174454233444550904Rat
11463849Trnas-cga3transfer RNA serine (anticodon CGA) 3174454294944543030Rat
11468428Trnar-acg6transfer RNA arginine (anticodon ACG) 6174454428144544353Rat
11394111Trnav-aac7transfer RNA valine (anticodon AAC) 7174454922944549301Rat
1306326Tada3lbtranscriptional adaptor 3 (NGG1 homolog, yeast)-like B174455196144553707Rat
1306652Prss16serine protease 16174455603944563826Rat
11422630Trnaq-cug7transfer RNA glutamine (anticodon CUG) 7174457684544576916Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)174457925744579338Rat
11384777Trnas-gcu11transfer RNA serine (anticodon GCU) 11174457925744579338Rat
1594366Pom121l2POM121 transmembrane nucleoporin-like 2174458802244595347Rat
11440272Trnam-cau7transfer RNA methionine (anticodon CAU) 7174459895844599029Rat
1304798Zfp184zinc finger protein 184174462579544645549Rat
7731832LOC102556476elongation factor Tu, mitochondrial-like174463212744634315Rat
11439713Trnas-aga7transfer RNA serine (anticodon AGA) 7174464696944647050Rat
7575386LOC102555506uncharacterized LOC102555506174465492144662098Rat
11435663Trnas-aga8transfer RNA serine (anticodon AGA) 8174465707244657153Rat
11474770Trnaq-cug8transfer RNA glutamine (anticodon CUG) 8174466050344660574Rat
11467209Trnam-cau8transfer RNA methionine (anticodon CAU) 8174466363144663702Rat
11459487Trnas-aga9transfer RNA serine (anticodon AGA) 9174466653344666613Rat
11395456Trnas-uga3transfer RNA serine (anticodon UGA) 3174466946744669548Rat
11391621Trnaq-cug9transfer RNA glutamine (anticodon CUG) 9174467376244673833Rat
11410733Trnas-aga10transfer RNA serine (anticodon AGA) 10174467453644674617Rat
11467602Trnar-ucu7transfer RNA arginine (anticodon UCU) 7174467663644676721Rat
11509903Trnak-uuu5transfer RNA lysine (anticodon UUU) 5174468711544687187Rat
11462763Trnam-cau9transfer RNA methionine (anticodon CAU) 9174468790244687973Rat
11404861Trnai-uau3transfer RNA isoleucine (anticodon UAU) 3174469638744696480Rat
11441723Trnaf-gaa6transfer RNA phenylalanine (anticodon GAA) 6174470569644705768Rat
11365248Trnai-aau10transfer RNA isoleucine (anticodon AAU) 10174470649544706568Rat
11465641Trnai-aau11transfer RNA isoleucine (anticodon AAU) 11174472769544727768Rat
1591796Hist1h2bchistone cluster 1, H2bc174473618444738393Rat
6497956LOC100910554histone H2A type 1-like174473855244739195Rat
1304905Hist1h2aohistone cluster 1, H2ao174474453444744931Rat
9366689LOC103694118uracil-DNA glycosylase pseudogene174474501944747412Rat
9087157LOC103690190histone H2A type 1-E174474768644748229Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17163676140Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17173413148Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17173413148Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17333697263676140Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17333697273413148Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17333697273413148Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17333697273413148Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17519104750191047Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17519104750191047Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17982730454827304Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171574375561036897Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171867614063676140Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171867614063676140Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172149095062195822Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172149095066490950Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172149095066490950Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172149095066490950Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172149095066490950Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172149095066490950Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172149095074823273Rat
70157Niddm32Non-insulin dependent diabetes mellitus QTL 324.34blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)172213681453475276Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172277506564946194Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172403061863676140Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172769095961794615Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172769095963994435Rat
2302377Scl61Serum cholesterol level QTL 614.36blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)172807358956207236Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172841314873413148Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)173097522875975228Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)173097522875975228Rat
10450503Bp386Blood pressure QTL 3860.28arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)173205588258468016Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173205588277922655Rat
2313854Bp343Blood pressure QTL 3433.9life span trait (VT:0005372)age at time of death (CMO:0001193)173330362753475276Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173330362778303627Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173330362785321557Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173628324577922655Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173779030673413148Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)174117605786176057Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)174117605786176057Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)174173108086731080Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174254187285446768Rat
631497Bp98Blood pressure QTL 983.66arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)174295602163994435Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174435615789356157Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100360053 UniSTS
  306945 UniSTS
  306969 UniSTS
  364723 UniSTS
  680447 UniSTS
  682505 UniSTS
UniSTS 488584 UniSTS