UniSTS:471851 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:471851

Symbol: UniSTS:471851
Previously known as:
RGD ID: 5503849
Expected Size: 1100 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X21,441,571 - 21,442,671 (+)MAPPERmRatBN7.2
Rnor_6.0X22,410,211 - 22,411,310NCBIRnor6.0
Rnor_5.0X64,170,492 - 64,171,592NCBIRnor5.0
RGSC_v3.4X41,838,764 - 41,839,863UniSTSRGSC3.4
CeleraX21,703,302 - 21,704,401UniSTS
Cytogenetic MapXq21UniSTS
Is Marker For: Genes:   Tspyl2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGCCGGTTGGTGTCTATTCTA
Reverse Primer CACTGCCCTCATTGTCCCCCTCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1563283Tspyl2TSPY-like 2X2143947821445208Rat

Nucleotide Sequences


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731181Uae27Urinary albumin excretion QTL 272.70.0059urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)X143491017Rat
70165Bp64Blood pressure QTL 645.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X144812931706553Rat
631204Gluco15Glucose level QTL 150.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X162371522646544Rat
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X292789847927898Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7440600049406000Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X449454949494549Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
71116Niddm16Non-insulin dependent diabetes mellitus QTL 167.81blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X1529780260297802Rat
1598873Memor2Memory QTL 22.5exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)X2099094741052531Rat
2290375Gluco34Glucose level QTL 342.75blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X2099094741203591Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 302612 UniSTS
UniSTS 471851 UniSTS