UniSTS:237712 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: UniSTS:237712

Symbol: UniSTS:237712
Previously known as:
RGD ID: 5503276
Expected Size: 88 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.279,650,401 - 9,650,571 (+)MAPPERmRatBN7.2
Rnor_6.0712,516,574 - 12,516,743NCBIRnor6.0
Rnor_5.0712,686,677 - 12,686,846UniSTSRnor5.0
RGSC_v3.4711,162,738 - 11,162,907UniSTSRGSC3.4
Celera77,826,258 - 7,826,427UniSTS
Cytogenetic Map7q11UniSTS
Is Marker For: Genes:   Gpx4  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATTGATAAGAACGGCTGCGT
Reverse Primer GCTAGAGATAGCACGGCAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
69226Gpx4glutathione peroxidase 4796501869652982Rat

Nucleotide Sequences
RefSeq Transcripts NM_001039849 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_017165 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB072798 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC099431 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ537598 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ210610 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ219811 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221663 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221760 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221899 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221976 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222299 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ224697 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227564 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227764 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ230991 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231108 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231686 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ233099 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ234630 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L24896 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U37427 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X82679 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29328 UniSTS
UniSTS 237712 UniSTS