Arhgap11a Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner
Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: Arhgap11a

Symbol: Arhgap11a
Also known as:
RGD ID: 5502847
Expected Size: 0 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.03105,283,318 - 105,284,067NCBIRnor6.0
Rnor_6.01422,787,507 - 22,788,240NCBIRnor6.0
Rnor_5.01422,687,413 - 22,688,146UniSTSRnor5.0
Rnor_5.03111,860,056 - 111,860,805UniSTSRnor5.0
RGSC_v3.41422,707,085 - 22,707,819UniSTSRGSC3.4
RGSC_v3.4399,678,442 - 99,679,191UniSTSRGSC3.4
Celera1420,582,978 - 20,583,711UniSTS
Celera399,562,821 - 99,563,570UniSTS
Cytogenetic Map14p21UniSTS
Cytogenetic Map3q34UniSTS
Is Marker For: Genes:   Arhgap11a   LOC689841   LOC686531  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAATCACCAGTTGTGTCCTGTG
Reverse Primer TTTTCCTCTGTTCGGTTCATTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1309107Arhgap11aRho GTPase activating protein 11A3105281827105298108Rat
1587539LOC689841similar to Rho GTPase activating protein 11A142278632922795349Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)330114912123700444Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)330846101172879276Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333477354108914061Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)339248391140271184Rat
1354597Kidm13Kidney mass QTL 132.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)343295930108914061Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)343295930163640485Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)343295930163640485Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)345406058127023997Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)345406058177699992Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)348561928155263151Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)351821836124513579Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)351822008120917851Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)354630948119830094Rat
1581568Rf53Renal function QTL 53total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)358204463170534769Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)361241033165369047Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)362922868127023997Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)366711607119830094Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)366711607119830094Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)372672290127023997Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)372973445127023997Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)378700444123700444Rat
1581546Pur13Proteinuria QTL 132.930.0335total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)381136227154416635Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)383817637119509260Rat
7387306Bw124Body weight QTL 1243.20.0003body mass (VT:0001259)body weight (CMO:0000012)388910015133910015Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)394788365139788365Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)397009185142009185Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)399465522168732722Rat
1582252Sual1Serum uric acid level QTL 13.40.0123blood uric acid amount (VT:0010302)blood uric acid level (CMO:0000501)3100730984106900596Rat
1582219Bw63Body weight QTL 633.80.001body mass (VT:0001259)body weight (CMO:0000012)3100730984119830094Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)3101058963146058963Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)3102152812155263151Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)3102466149147466149Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)3103141814176418101Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)3103141814176418101Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3103141814176418101Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)3103141944170934860Rat
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
619619Rf4Renal disease susceptibility QTL 44.10.002total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14134403399Rat
9589814Gluco67Glucose level QTL 674.540.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14141333960Rat
7411573Bw139Body weight QTL 1394.70.001body mass (VT:0001259)body weight gain (CMO:0000420)14141333960Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14142766285Rat
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14483323323004027Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14483323326466248Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14483323333040042Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14975643572854397Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin141053997755539977Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)141053997755539977Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)141072926861873323Rat
2302277Gluco38Glucose level QTL 385.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141268042430155192Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1412680424106641756Rat
631212Bw5Body weight QTL55.43retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)141268061332593926Rat
1300140Srn3Serum renin concentration QTL 33.19blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)141633698833163485Rat
631528Scl11Serum cholesterol level QTL 114.9blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)141915991938289187Rat
71117Niddm17Non-insulin dependent diabetes mellitus QTL 172.35blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)141916189343957503Rat
631262Tcas4Tongue tumor susceptibility QTL 47.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)141919154143957628Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)142018938665189386Rat
61420Pia6Pristane induced arthritis QTL 64.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)142026622343957628Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)142145756566457565Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 296060 UniSTS
  686531 UniSTS
  689841 UniSTS
UniGene Rn.51673 UniSTS
UniSTS 506737 UniSTS