RH124814 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH124814

Symbol: RH124814
Previously known as:
RGD ID: 5502431
Expected Size: 96 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2518,469,458 - 18,469,554 (-)MAPPERmRatBN7.2
mRatBN7.21130,922,939 - 30,923,035 (+)MAPPERmRatBN7.2
Rnor_6.01131,837,542 - 31,837,637NCBIRnor6.0
Rnor_5.01135,446,275 - 35,446,370UniSTSRnor5.0
RGSC_v3.41131,651,924 - 31,652,019UniSTSRGSC3.4
Celera1130,590,371 - 30,590,466UniSTS
Cytogenetic Map11q11UniSTS
Is Marker For: Genes:   Donson   Son  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCTCAGTCAACAAAATAGCG
Reverse Primer ATTTCAGCTACACCTAGATAGACG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
9196141Son-ps1SON DNA and RNA binding protein, pseudogene 151846947618473456Rat
1306823DonsonDNA replication fork stabilization factor DONSON113091983430933150Rat
1309013SonSON DNA and RNA binding protein113085089030923167Rat

Nucleotide Sequences
RefSeq Transcripts NM_001170327 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC120736 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5190450412Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)572947086724018Rat
2312562Pur18Proteinuria QTL 182.60.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)5213896532656739Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5228222669540447Rat
2313085Bss59Bone structure and strength QTL 592.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)5384401826141981Rat
1300117Hrtrt8Heart rate QTL 83.49heart pumping trait (VT:2000009)heart rate (CMO:0000002)5384401847869213Rat
61462Niddm10Non-insulin dependent diabetes mellitus QTL 103.90.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)5511215947171491Rat
631827Alc4Alcohol consumption QTL 43.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)5818750118616199Rat
2293666Bmd38Bone mineral density QTL 384.4femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)5894822853948228Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5982326699753708Rat
1641903Alcrsp3Alcohol response QTL 3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)51268928557689285Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512789751113558310Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11135331169Rat
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat
724517Uae18Urinary albumin excretion QTL 183.7urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)111647204744285911Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
10058952Gmadr6Adrenal mass QTL 62.290.0072adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)112295940367959403Rat
8694376Bw156Body weight QTL 1562.250.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
9590313Scort20Serum corticosterone level QTL 206.510.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)112328045668280456Rat
9589032Epfw10Epididymal fat weight QTL 109.290.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)112328045668280456Rat
8694424Bw162Body weight QTL 1623.80.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
1300130Rf20Renal function QTL 204.44kidney glomerulus integrity trait (VT:0010546)kidney glomerulus diameter (CMO:0001166)112952841860324829Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)112952841882566702Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 288257 UniSTS
  304092 UniSTS
UniSTS 161636 UniSTS