PMC123023P3 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: PMC123023P3

Symbol: PMC123023P3
Also known as:
RGD ID: 5501019
Expected Size: 332 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21251,245,148 - 251,245,480 (+)MAPPER
mRatBN7.21197,843,337 - 197,844,168 (+)MAPPER
Rnor_6.01215,857,028 - 215,857,858NCBIRnor6.0
Rnor_6.01272,799,960 - 272,800,291NCBIRnor6.0
Rnor_5.01280,213,791 - 280,214,122UniSTSRnor5.0
Rnor_5.01222,751,847 - 222,752,677UniSTSRnor5.0
RGSC_v3.41202,935,549 - 202,936,379UniSTSRGSC3.4
RGSC_v3.41258,001,297 - 258,001,628UniSTSRGSC3.4
Celera1246,946,590 - 246,946,921UniSTS
Celera1195,461,370 - 195,462,200UniSTS
Cytogenetic Map1q41UniSTS
Cytogenetic Map1q54-q55UniSTS
Is Marker For: Genes:   Ins1   Ins2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGGCCCTGTGGATGCGCTT
Reverse Primer TAGTTGCAGTAGTTCTCCAGCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2916Ins2insulin 21215856967215858034Rat
7585225LOC102549750uncharacterized LOC1025497501215881009215939811Rat
11378084LOC108349673uncharacterized LOC1083496731215986859215989549Rat
3853Thtyrosine hydroxylase1216073034216080287Rat
2159Ascl2achaete-scute family bHLH transcription factor 21216154002216156409Rat
7692070LOC102549151uncharacterized LOC1025491511216178799216184565Rat
1308721Tspan32tetraspanin 321216189535216206202Rat
7577477LOC102550186uncharacterized LOC1025501861216230707216236566Rat
2315Cd81Cd81 molecule1216237663216253460Rat
1307043Tssc4tumor suppressing subtransferable candidate 41216253786216256610Rat
1310620Trpm5transient receptor potential cation channel, subfamily M, member 51216256653216281504Rat
621503Kcnq1potassium voltage-gated channel subfamily Q member 11216293087216630339Rat
727892Cdkn1ccyclin-dependent kinase inhibitor 1C1216661067216663791Rat
1303323Slc22a18solute carrier family 22, member 181216676330216700632Rat
1304755Phlda2pleckstrin homology-like domain, family A, member 21216701345216704479Rat
1305391Nap1l4nucleosome assembly protein 1-like 41216715352216751742Rat
1310747Carscysteinyl-tRNA synthetase1216759367216801652Rat
1309693Tnfrsf26tumor necrosis factor receptor superfamily, member 261216808642216829361Rat
1586688Tnfrsf22tumor necrosis factor receptor superfamily, member 221216845789216859606Rat
1308402Osbpl5oxysterol binding protein-like 51216866263216920625Rat
9445960LOC103691270uncharacterized LOC1036912701216934099216936936Rat
1562011RGD1562011similar to MAS-related G-protein coupled receptor, member G1216941913216942791Rat
738044MrgprgMAS related GPR family member G1216952942216955673Rat
738045MrgpreMAS related GPR family member E1216969464216973936Rat
727801Nadsyn1NAD synthetase 11216985710217013743Rat
621769Dhcr77-dehydrocholesterol reductase1217018916217034890Rat
7506405LOC102552318actin-like1217039727217066768Rat
628772Shank2SH3 and multiple ankyrin repeat domains 21217149156217593950Rat
11459734LOC10834967460S ribosomal protein L21 pseudogene1217157580217159437Rat
619839Cttncortactin1217602698217638196Rat
1309009Ppfia1PTPRF interacting protein alpha 11217644259217721285Rat
11497536LOC10834967660S ribosomal protein L7a pseudogene1217687271217688236Rat
2324580LOC100364769LRRG00136-like1217699180217735742Rat
628700FaddFas associated via death domain1217746176217748581Rat
1310786Ano1anoctamin 11217754349217902540Rat
11484604LOC108349677uncharacterized LOC1083496771217930453217933849Rat
620126Fgf3fibroblast growth factor 31218003018218006942Rat
11455008LOC108349678uncharacterized LOC1083496781218007765218020101Rat
620127Fgf4fibroblast growth factor 41218024537218029539Rat
620166Fgf19fibroblast growth factor 191218058405218061693Rat
2193Bc1brain cytoplasmic RNA 11218075359218075511Rat
1304637Lto1LTO1 maturation factor of ABCE11218075995218082700Rat
9441275LOC10369127140S ribosomal protein S10 pseudogene1218084336218087286Rat
68384Ccnd1cyclin D11218090750218100447Rat
11418059LOC108349679uncharacterized LOC1083496791218227882218233736Rat
628800Smim38small integral membrane protein 381218369204218374619Rat
1311779Tpcn2two pore segment channel 21218419182218448902Rat
708478MrgprfMAS related GPR family member F1218465642218476228Rat
738040MrgprdMAS related GPR family member D1218481146218491910Rat
68325Ighmbp2immunoglobulin mu DNA binding protein 21218509274218531922Rat
1310203Mrpl21mitochondrial ribosomal protein L211218532045218545428Rat
2396Cpt1acarnitine palmitoyltransferase 1A1218568157218629679Rat
1309788Tesmintestis expressed metallothionein like protein1218632764218651054Rat
61954Galgalanin and GMAP prepropeptide1218653059218657922Rat
1307145Ppp6r3protein phosphatase 6, regulatory subunit 31218695738218810139Rat
11504246Trnan-guu1transfer RNA asparagine (anticodon GUU) 11218751801218751873Rat
7622947LOC102552426something about silencing protein 10-like1218801896218802714Rat
9323695LOC103691272uncharacterized LOC1036912721218806376218810016Rat
11443599Trnaa-agc1transfer RNA alanine (anticodon AGC) 11218810648218810720Rat
1309329Lrp5LDL receptor related protein 51218816833218920147Rat
11366915LOC10834972540S ribosomal protein S9 pseudogene1218912110218919902Rat
1311946RGD1311946similar to RIKEN cDNA 1810055G021218945565218954274Rat
1306343Fam18b-ps1family with sequence similarity 18, member B, pseudogene 11218971434218973077Rat
11360999LOC108349680uncharacterized LOC1083496801218983196218990207Rat
11374033LOC108349681uncharacterized LOC1083496811218990288218995715Rat
1311637Kmt5blysine methyltransferase 5B1219000844219050211Rat
11470190Trnap-agg2transfer RNA proline (anticodon AGG) 21219060571219060642Rat
61944Chkacholine kinase alpha1219076618219126221Rat
735136Tcirg1T-cell immune regulator 1, ATPase H+ transporting V0 subunit A31219126687219139466Rat
1309436Ndufs8NADH:ubiquinone oxidoreductase core subunit S81219141289219144610Rat
1359546Aldh3b1aldehyde dehydrogenase 3 family, member B11219145457219181536Rat
1311984Unc93b1unc-93 homolog B1, TLR signaling regulator1219172987219183941Rat
1585230LOC688778similar to fatty aldehyde dehydrogenase-like1219193465219207062Rat
1584166Aldh3b2aldehyde dehydrogenase 3 family, member B21219215023219218488Rat
1305394Acy3aminoacylase 31219233712219237103Rat
1584144Tbx10T-box transcription factor 101219237204219246480Rat
9288417LOC103691273uncharacterized LOC1036912731219246563219247276Rat
1309040Nudt8nudix hydrolase 81219247428219249155Rat
1307473Doc2gdouble C2-like domains, gamma1219249253219253790Rat
1359247Ndufv1NADH:ubiquinone oxidoreductase core subunit V11219254293219259328Rat
2758Gstp1glutathione S-transferase pi 11219291679219294147Rat
1307603RGD1307603similar to hypothetical protein MGC379141219309593219312240Rat
1563670Cabp2calcium binding protein 21219329186219335046Rat
1588883Cdk2ap2cyclin-dependent kinase 2 associated protein 21219345638219347709Rat
1306710Pitpnm1phosphatidylinositol transfer protein, membrane-associated 11219348672219362094Rat
628619Aiparyl-hydrocarbon receptor-interacting protein1219361859219373924Rat
11458427LOC108349683uncharacterized LOC1083496831219369024219369963Rat
1305824Tmem134transmembrane protein 1341219374005219383365Rat
1306083Cabp4calcium binding protein 41219383452219388009Rat
1584082Gpr152G protein-coupled receptor 1521219389418219394124Rat
11401413LOC10834968260S ribosomal protein L35a1219395235219395704Rat
2382Coro1bcoronin 1B1219397827219403253Rat
1559601Ptprcapprotein tyrosine phosphatase, receptor type, C-associated protein1219403970219406129Rat
1305144Rps6kb2ribosomal protein S6 kinase B21219406201219412888Rat
1308234Carns1carnosine synthase 11219413897219424533Rat
1311490Tbc1d10cTBC1 domain family, member 10C1219431094219439102Rat
3375Ppp1caprotein phosphatase 1 catalytic subunit alpha1219439953219443570Rat
2319938Rad9aRAD9 checkpoint clamp component A1219443347219450574Rat
1303171Clcf1cardiotrophin-like cytokine factor 11219468866219472445Rat
1308519Pold4DNA polymerase delta 4, accessory subunit1219480841219483244Rat
9106200LOC103691274uncharacterized LOC1036912741219508381219511997Rat
1308679Ssh3slingshot protein phosphatase 31219511908219519398Rat
1309156Ankrd13dankyrin repeat domain 13D1219520316219532718Rat
2062Grk2G protein-coupled receptor kinase 21219536220219544329Rat
1309419Kdm2alysine demethylase 2A1219566130219642294Rat
1310985Rhodras homolog family member D1219668352219682287Rat
621876Syt12synaptotagmin 121219690013219719359Rat
1597421LOC689065hypothetical protein LOC6890651219743744219758867Rat
1597413LOC689073similar to solute carrier family 25, member 51219748353219749710Rat
3262Pcpyruvate carboxylase1219759157219859854Rat
1585286Lrfn4leucine rich repeat and fibronectin type III domain containing 41219850037219855771Rat
1309261Rce1Ras converting CAAX endopeptidase 11219860826219863933Rat
1563323RGD1563323similar to hypothetical protein FLJ225311219864108219952143Rat
3751Sptbn2spectrin, beta, non-erythrocytic 21219964429220006811Rat
7689565LOC102553046uncharacterized LOC1025530461219966590219968614Rat
1359343Rbm4bRNA binding motif protein 4B1220009397220019488Rat
1306891Rbm4RNA binding motif protein 41220038403220049756Rat
620542Rbm14RNA binding motif protein 141220048740220067124Rat
620403Ccscopper chaperone for superoxide dismutase1220075251220096319Rat
11455274LOC108349684uncharacterized LOC1083496841220077660220083679Rat
9461220LOC103691275uncharacterized LOC1036912751220091909220095065Rat
1596153Ccdc87coiled-coil domain containing 871220096478220099174Rat
1308181Ctsfcathepsin F1220114228220119976Rat
621792Actn3actinin alpha 31220120532220136460Rat
1565630Zdhhc24zinc finger, DHHC-type containing 241220137280220143387Rat
1307581Bbs1Bardet-Biedl syndrome 11220146084220165545Rat
621127Dpp3dipeptidylpeptidase 31220166124220189762Rat
1305989Peli3pellino E3 ubiquitin protein ligase family member 31220191209220204032Rat
1359665mrpl11mitochondrial ribosomal protein L111220243469220246340Rat
628866Npas4neuronal PAS domain protein 41220260310220278177Rat
11429602LOC108349788uncharacterized LOC1083497881220292623220296166Rat
6491308LOC100911721equilibrative nucleoside transporter 2-like1220306607220314631Rat
69296Slc29a2solute carrier family 29 member 21220306622220314631Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)1220322285220322366Rat
11425556Trnas-gcu2transfer RNA serine (anticodon GCU) 21220322285220322366Rat
6490825LOC100911750N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase-like1220322811220325078Rat
1309541B4gat1beta-1,4-glucuronyltransferase 11220322854220325076Rat
6490633LOC100911841breast cancer metastasis-suppressor 1 homolog1220325292220334621Rat
1311057Brms1BRMS1, transcriptional repressor and anoikis regulator1220325352220334616Rat
9473660LOC103691276uncharacterized LOC1036912761220334287220338245Rat
6491077LOC100911794ras and Rab interactor 1-like1220335036220342319Rat
620006Rin1Ras and Rab interactor 11220335036220342319Rat
1310404Cd248CD248 molecule1220353308220355872Rat
6490171LOC100911882endosialin-like1220353317220355862Rat
7597324LOC102554272uncharacterized LOC1025542721220356873220361281Rat
9260686LOC103689952transmembrane protein 151A1220373288220378076Rat
1310680Tmem151atransmembrane protein 151A1220373288220378080Rat
11416805LOC108349789uncharacterized LOC1083497891220377954220389469Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)1220415449220415530Rat
11469000Trnas-gcu3transfer RNA serine (anticodon GCU) 31220415449220415530Rat
11367424LOC108348067endosialin1220446433220448979Rat
7694107LOC102554466uncharacterized LOC1025544661220449990220454399Rat
628749Yif1aYip1 interacting factor homolog A, membrane trafficking protein1220470070220474131Rat
1304930Cnih2cornichon family AMPA receptor auxiliary protein 21220474485220480723Rat
7658496LOC102555354uncharacterized LOC1025553541220478568220493510Rat
1359415Rab1b-ps1RAB1B, member RAS oncogene family, pseudogene 11220480828220491456Rat
1642882Rab1bRAB1B, member RAS oncogene family1220483529220491469Rat
1307377Klc2kinesin light chain 21220492174220502397Rat
620579Pacs1phosphofurin acidic cluster sorting protein 11220515117220645611Rat
7547519LOC102554619junctional adhesion molecule A-like1220610641220612181Rat
1307159Sf3b2splicing factor 3b, subunit 21220645685220665611Rat
1564991Gal3st3galactose-3-O-sulfotransferase 31220668544220678300Rat
1593515Catsper1cation channel, sperm associated 11220715000220724235Rat
628799Cst6cystatin E/M1220727292220729000Rat
620662Banf1BAF nuclear assembly factor 11220744195220746224Rat
1304686Eif1adeukaryotic translation initiation factor 1A domain containing1220746387220751687Rat
9257852LOC103691278uncharacterized LOC1036912781220758437220761316Rat
61930Sart1spliceosome associated factor 1, recruiter of U4/U6.U5 tri-snRNP1220762496220771158Rat
7583741LOC102555676uncharacterized LOC1025556761220771259220774273Rat
1302964Tsga10iptestis specific 10 interacting protein1220772592220786952Rat
1308477Drap1Dr1 associated protein 11220803783220806480Rat
628612Bles03basophilic leukemia expressed protein BLES031220806563220808817Rat
2627Fosl1FOS like 1, AP-1 transcription factor subunit1220826560220835066Rat
1565319Ccdc85bcoiled-coil domain containing 85B1220835647220837220Rat
628715FibpFGF1 intracellular binding protein1220840078220844412Rat
1309354Ctswcathepsin W1220844579220847967Rat
1359496Efemp2EGF containing fibulin extracellular matrix protein 21220853695220861420Rat
1311957Mus81MUS81 structure-specific endonuclease subunit1220862474220867973Rat
69285Cfl1cofilin 11220869805220873337Rat
1560591Snx32sorting nexin 321220873782220890804Rat
7571422LOC102551929melanoma-associated antigen G1-like1220882084220884570Rat
7510674LOC102556290nipped-B-like protein B-like1220893296220921333Rat
1306956Ovol1ovo like transcriptional repressor 11220927309220938814Rat
1562657Ap5b1adaptor related protein complex 5 subunit beta 11220948318220952349Rat
2319141Rnaseh2cribonuclease H2, subunit C1220966626220967717Rat
621061Kat5lysine acetyltransferase 51220967795220974596Rat
727889RelaRELA proto-oncogene, NF-kB subunit1220992770221003249Rat
9230430LOC10369128160S ribosomal protein L29 pseudogene1220998976221000285Rat
1303184Sipa1signal-induced proliferation-associated 11221006305221018820Rat
1305529Pcnx3pecanex 31221019091221041959Rat
1359261Map3k11mitogen-activated protein kinase kinase kinase 111221043119221056420Rat
7631854LOC102546344uncharacterized LOC1025463441221048141221049236Rat
1565025Kcnk7potassium two pore domain channel subfamily K member 71221056477221060607Rat
1563823Ehbp1l1EH domain binding protein 1-like 11221061878221084423Rat
1311544Fam89bfamily with sequence similarity 89, member B1221085894221087449Rat
1593467Znrd2zinc ribbon domain containing 21221087803221089586Rat
62057Ltbp3latent transforming growth factor beta binding protein 31221099155221116096Rat
1307330Scyl1SCY1 like pseudokinase 11221115992221129668Rat
9149523LOC103691279uncharacterized LOC1036912791221151827221152211Rat
7718374LOC102547101uncharacterized LOC1025471011221151938221153643Rat
1310323Frmd8FERM domain containing 81221213312221233967Rat
1589953Slc25a45solute carrier family 25, member 451221236817221244564Rat
1305393Tigd3tigger transposable element derived 31221248546221252284Rat
1311699Dpf2double PHD fingers 21221253764221269043Rat
1310253Cdc42ep2CDC42 effector protein 21221272349221281252Rat
11407041LOC10834887540S ribosomal protein S27-like1221290471221290746Rat
621817Pola2DNA polymerase alpha 2, accessory subunit1221297417221321601Rat
1311460Slc22a20solute carrier family 22 member 201221327608221344367Rat
2267Capn1calpain 11221346081221370965Rat
11462351LOC108349685uncharacterized LOC1083496851221370803221402616Rat
1310488Syvn1synoviolin 11221409281221416229Rat
1309920Mrpl49mitochondrial ribosomal protein L491221417336221420115Rat
61938FauFAU, ubiquitin like and ribosomal protein S30 fusion1221420312221421827Rat
1307918Znhit2zinc finger, HIT-type containing 21221424383221425664Rat
1311205Tm7sf2transmembrane 7 superfamily member 21221426017221430340Rat
7489020Mir6315microRNA 63151221433993221434093Rat
2318452Tmem262transmembrane protein 2621221443477221445043Rat
1586738Zfpl1zinc finger protein-like 11221444588221448555Rat
1560863Cdca5cell division cycle associated 51221448661221462235Rat
620987Naaladl1N-acetylated alpha-linked acidic dipeptidase-like 11221470675221484222Rat
9342622LOC103691280uncharacterized LOC1036912801221481664221482878Rat
1308049Sac3d1SAC3 domain containing 11221484210221486669Rat
1305803Snx15sorting nexin 151221487058221496200Rat
69326Arl2ADP-ribosylation factor like GTPase 21221504150221516191Rat
1311481Batf2basic leucine zipper ATF-like transcription factor 21221538006221546650Rat
1563886Majinmembrane anchored junction protein1221540551221594124Rat
11416317LOC108349686uncharacterized LOC1083496861221572259221576486Rat
621748Gpha2glycoprotein hormone subunit alpha 21221594110221597297Rat
727786Ppp2r5bprotein phosphatase 2, regulatory subunit B', beta1221597294221605467Rat
1589890Atg2aautophagy related 2A1221612584221632291Rat
2325554Mir194-2microRNA 194-21221634786221634870Rat
2325427Mir192microRNA 1921221634971221635080Rat
1309017Ehd1EH-domain containing 11221644867221667242Rat
1307260Cdc42bpgCDC42 binding protein kinase gamma1221673334221693518Rat
3078Men1menin 11221704394221710343Rat
1308199Map4k2mitogen activated protein kinase kinase kinase kinase 21221710622221726274Rat
11474686LOC108349687uncharacterized LOC1083496871221725777221735365Rat
620645Sf1splicing factor 11221735512221749216Rat
3461Pygmglycogen phosphorylase, muscle associated1221756325221771142Rat
1311630Rasgrp2RAS guanyl releasing protein 21221771238221788765Rat
620211Nrxn2neurexin 21221792191221908047Rat
621628Slc22a12solute carrier family 22 member 121221910787221919277Rat
7526936LOC10254850760S ribosomal protein L29-like1221957751221958406Rat
1566262RGD1566262similar to 2610524G07Rik protein1221993278221994037Rat
1307277Rps6ka4ribosomal protein S6 kinase A41222087328222098284Rat
1311475Ccdc88bcoiled-coil domain containing 88B1222102436222118485Rat
1586339LOC689961similar to ATP synthase lipid-binding protein, mitochondrial precursor1222142427222142893Rat
71007Prdx5peroxiredoxin 51222164462222167447Rat
1309710Trmt112tRNA methyltransferase activator subunit 11-21222167927222168780Rat
1583866Esrraestrogen related receptor, alpha1222168729222178842Rat
2318763Catsperzcatsper channel auxiliary subunit zeta1222179451222182716Rat
621449Kcnk4potassium two pore domain channel subfamily K member 41222182997222192139Rat
1586317Gpr137G protein-coupled receptor 1371222194266222197252Rat
620103BadBCL2-associated agonist of cell death1222198516222207459Rat
61993Plcb3phospholipase C beta 31222207887222224993Rat
628702Ppp1r14bprotein phosphatase 1, regulatory (inhibitor) subunit 14B1222229835222231945Rat
1560660Fkbp2FKBP prolyl isomerase 21222232349222235113Rat
619799Vegfbvascular endothelial growth factor B1222237000222242786Rat
1308693Dnajc4DnaJ heat shock protein family (Hsp40) member C41222242889222247115Rat
735224Nudt22nudix hydrolase 221222247500222251053Rat
1310831Trpt1tRNA phosphotransferase 11222250995222255994Rat
1310168Fermt3FERM domain containing kindlin 31222254183222272775Rat
621599Stip1stress-induced phosphoprotein 11222274133222293139Rat
628701Macrod1mono-ADP ribosylhydrolase 11222310916222451485Rat
1565152Flrt1fibronectin leucine rich transmembrane protein 11222340481222417915Rat
11472459LOC108349688uncharacterized LOC1083496881222431735222438058Rat
1311329Otub1OTU deubiquitinase, ubiquitin aldehyde binding 11222451674222459952Rat
620638Cox8acytochrome c oxidase subunit 8A1222466575222468896Rat
1565838Naa40N(alpha)-acetyltransferase 40, NatD catalytic subunit1222478021222495382Rat
7597569LOC102551606heterogeneous nuclear ribonucleoprotein R-like1222482952222485422Rat
1359467Rcor2REST corepressor 21222513970222525356Rat
708483Mark2microtubule affinity regulating kinase 21222525547222590727Rat
1308106Spindocspindlin interactor and repressor of chromatin binding1222606302222628839Rat
1560108Zftazinc finger translocation associated1222669642222677372Rat
620988Rtn3reticulon 31222677359222734307Rat
7610772LOC102551693uncharacterized LOC1025516931222743765222745836Rat
1309871Atl3atlastin GTPase 31222746023222788439Rat
1585448LOC686151similar to cell division cycle associated 51222809806222811475Rat
1563402RGD1563402similar to Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 11222822136222822848Rat
2829Plaat3phospholipase A and acyltransferase 31222844238222877180Rat
1306914Lgals12galectin 121222891626222903728Rat
1308376Plaat5phospholipase A and acyltransferase 51222907159222937643Rat
1583865LOC293712similar to 60S ribosomal protein L71222957207222958131Rat
628885Slc22a24solute carrier family 22, member 241222969899223522893Rat
6499582LOC100910252sororin-like1223017372223017899Rat
1309745Sirpb2signal-regulatory protein beta 21223214091223264272Rat
1583989LOC690183similar to DnaJ homolog subfamily B member 6 (Heat shock protein J2) (HSJ-2) (MRJ) (mDj4)1223548728223550015Rat
1583981LOC690192similar to integral membrane transport protein UST4r1223570960223574634Rat
1333919Olr1848-psolfactory receptor pseudogene 18481224075014224075376Rat
11449059LOC10834986360S ribosomal protein L19 pseudogene1224112686224113253Rat
11373429LOC10834986460S ribosomal protein L19 pseudogene1224202800224203382Rat
1334042Olr1787-psolfactory receptor pseudogene 17871224241083224241706Rat
620976UST4rintegral membrane transport protein UST4r1224319927224389499Rat
620985Ust5rintegral membrane transport protein UST5r1224457895224533994Rat
621104Slc22a25solute carrier family 22, member 251224596886224698512Rat
11482888LOC108349689enhancer of rudimentary homolog pseudogene1224686506224687299Rat
9081279LOC103691284uncharacterized LOC1036912841224770260224773664Rat
9305038LOC10369128840S ribosomal protein S12-like1224781223224791360Rat
632286Slc22a8solute carrier family 22 member 81224799444224818482Rat
7726978LOC102550957uncharacterized LOC1025509571224819631224828153Rat
69338Slc22a6solute carrier family 22 member 61224824809224833284Rat
2342Chrm1cholinergic receptor, muscarinic 11224869087224885101Rat
3073Slc3a2solute carrier family 3 member 21224906566224921029Rat
6489539LOC100912041uncharacterized LOC1009120411224921300224924589Rat
1582860LOC690251similar to SUMO/sentrin specific protease 51224927683224931006Rat
1582881Wdr74WD repeat domain 741224933906224938659Rat
68426Stx5syntaxin 51224939497224955658Rat
62014Nxf1nuclear RNA export factor 11224957535224970728Rat
1582829Tmem223transmembrane protein 2231224970807224972168Rat
1582850Tmem179btransmembrane protein 179B1224972218224975091Rat
1310123Taf6lTATA-box binding protein associated factor 6 like1224974238224986819Rat
621284Polr2gRNA polymerase II subunit G1224991250224998355Rat
1561140Zbtb3zinc finger and BTB domain containing 31224998092225002951Rat
1359253Ttc9ctetratricopeptide repeat domain 9C1225003859225014867Rat
1562784Hnrnpul2heterogeneous nuclear ribonucleoprotein U-like 21225015722225027640Rat
620805Gng3G protein subunit gamma 31225033921225035687Rat
1308135Bscl2BSCL2 lipid droplet biogenesis associated, seipin1225035956225046137Rat
1597359Lrrn4clLRRN4 C-terminal like1225046248225050963Rat
1309471Ubxn1UBX domain protein 11225067953225071944Rat
1597344Uqcc3ubiquinol-cytochrome c reductase complex assembly factor 31225076301225077079Rat
1597339RGD1597339uncharacterized protein LOC6903491225080183225087291Rat
7587874LOC102551607uncharacterized LOC1025516071225091229225092429Rat
1309370Ints5integrator complex subunit 51225091612225096390Rat
1309775Ganabglucosidase II alpha subunit1225096558225116384Rat
9095278LOC103691285uncharacterized LOC1036912851225106153225118841Rat
1311968B3gat3beta-1,3-glucuronyltransferase 31225120061225126579Rat
1306070Rom1retinal outer segment membrane protein 11225126732225128740Rat
7630023Eml3EMAP like 31225128997225140472Rat
1306743Mta2metastasis associated 1 family, member 21225140863225149584Rat
1561043Tut1terminal uridylyl transferase 1, U6 snRNA-specific1225151462225162445Rat
1302939Eef1geukaryotic translation elongation factor 1 gamma1225163391225173997Rat
619779AhnakAHNAK nucleoprotein1225184883225429638Rat
11408066LOC108349690uncharacterized LOC1083496901225242712225243729Rat
3934Scgb1a1secretoglobin family 1A member 11225279698225283246Rat
708526Asrgl1asparaginase and isoaspartyl peptidase 11225309737225329743Rat
11496861LOC108348288prostatic steroid-binding protein C1-like1225456875225460005Rat
1566289RGD1566289similar to probable nocturnin protein1225470386225583604Rat
1596054LOC690454similar to dendritic cell-derived ubiquitin-like protein1225582137225583520Rat
708459Scgb1d2secretoglobin, family 1D, member 21225591848225601716Rat
9301867LOC103691289prostatic steroid-binding protein C1-like1225597509225631459Rat
11491810LOC108349790uncharacterized LOC1083497901225620682225625554Rat
1596035LOC690475similar to ribosomal protein S241225655320225655715Rat
1302961Scgb1d4secretoglobin family 1D member 41225690756225693631Rat
9161284LOC103691290prostatic steroid-binding protein C1-like1225781000225781140Rat
9457059LOC103691291nocturnin-like1225804872225818000Rat
3424Scgb2a2secretoglobin, family 2A, member 21225825419225830374Rat
735031Scgb2a1secretoglobin, family 2A, member 11225899313225902676Rat
68339Fads2fatty acid desaturase 21225906582226152568Rat
1305292Incenpinner centromere protein1225923448225953384Rat
7587044LOC102552566uncharacterized LOC1025525661225959977226026713Rat
7704907LOC1025523942'-deoxynucleoside 5'-phosphate N-hydrolase 1-like1226008454226009518Rat
2635Fth1ferritin heavy chain 11226030940226033228Rat
1311656Best1bestrophin 11226033146226049893Rat
7613394LOC102554361UPF0462 protein C4orf33 homolog1226037925226039407Rat
619764Rab3il1RAB3A interacting protein-like 11226077182226084830Rat
628876Fads3fatty acid desaturase 31226091774226108332Rat
1593460LOC690604similar to esterase D/formylglutathione hydrolase1226229336226231208Rat
621678Fads1fatty acid desaturase 11226234034226249118Rat
621821Fen1flap structure-specific endonuclease 11226251516226256160Rat
1560328Tmem258transmembrane protein 2581226256142226260006Rat
1306622Myrfmyelin regulatory factor1226260558226292650Rat
1359461Dagladiacylglycerol lipase, alpha1226297013226353712Rat
6495087LOC10091110560S ribosomal protein L10-like1226359891226360790Rat
7557864LOC102552972uncharacterized LOC1025529721226360996226373571Rat
11381356LOC108349691histone H3.3-like1226361265226361814Rat
11365600LOC108349692uncharacterized LOC1083496921226426922226428840Rat
62013Syt7synaptotagmin 71226435816226498008Rat
1564983Lrrc10bleucine rich repeat containing 10B1226500692226501920Rat
708532Ppp1r32protein phosphatase 1, regulatory subunit 321226518405226527903Rat
1309216Sdhaf2succinate dehydrogenase complex assembly factor 21226543671226572414Rat
1305441Cpsf7cleavage and polyadenylation specific factor 71226572399226596185Rat
9312765LOC103691286uncharacterized LOC1036912861226596035226599720Rat
7662576LOC102554522TD and POZ domain-containing protein 2-like1226599983226601456Rat
1304607Tmem216transmembrane protein 2161226601201226606417Rat
1561525RGD1561525similar to ribosomal protein L311226618116226618545Rat
1304670Cyb561a3cytochrome b561 family, member A31226620933226642246Rat
735168Tmem138transmembrane protein 1381226623861226630911Rat
1311026Tkfctriokinase and FMN cyclase1226642901226657698Rat
621889Ddb1damage-specific DNA binding protein 11226657561226683356Rat
1309910Vwcevon Willebrand factor C and EGF domains1226687258226717989Rat
621573Pga5pepsinogen A51226722198226732736Rat
11384366Vps37cVPS37C subunit of ESCRT-I1226742267226774109Rat
2309Cd5Cd5 molecule1226770912226791861Rat
9307211LOC103691287uncharacterized LOC1036912871226836577226839314Rat
2312Cd6Cd6 molecule1226848399226887259Rat
628663Slc15a3solute carrier family 15 member 31226896387226912644Rat
727936Tmem132atransmembrane protein 132A1226912562226925023Rat
1359538Tmem109transmembrane protein 1091226925114226935710Rat
708496Prpf19pre-mRNA processing factor 191226947065226958147Rat
620604Zp1zona pellucida glycoprotein 11226966366226972746Rat
1311986Ptgdr2prostaglandin D2 receptor 21226976455226995641Rat
1359280Ccdc86coiled-coil domain containing 861226996435227002016Rat
1307478Ms4a10membrane spanning 4-domains A101227016795227030220Rat
1561158Ms4a15membrane spanning 4-domains A151227033796227048718Rat
2323808Ms4a18membrane spanning 4-domains A181227050349227071485Rat
6495244LOC100911030uncharacterized LOC1009110301227093975227108899Rat
6495605LOC100910973uncharacterized LOC1009109731227110936227113844Rat
1583864LOC293740similar to Sorting nexin-51227117061227119809Rat
1309035Ms4a8membrane spanning 4-domains A81227136154227149748Rat
2323653LOC100359541rCG47147-like1227157087227162748Rat
7639871LOC102557108uncharacterized LOC1025571081227157087227321873Rat
11421728LOC108349693solute carrier family 15 member 3 pseudogene1227195510227201990Rat
6493207Ms4a4emembrane spanning 4-domains A4E1227217708227232337Rat
1359381Ms4a6blmembrane-spanning 4-domains, subfamily A, member 6B-like1227240419227252244Rat
9103818LOC103690088uncharacterized LOC1036900881227277842227290363Rat
6487805LOC100912336membrane-spanning 4-domains subfamily A member 12-like1227330033227361341Rat
1564175Ms4a13-ps1membrane spanning 4-domains A13, pseudogene 11227365517227395001Rat
1307162Ms4a12membrane spanning 4-domains A121227403937227417504Rat
9088826LOC10369129260S ribosomal protein L6 pseudogene1227409338227415472Rat
1311999Ms4a1membrane spanning 4-domains A11227429241227441492Rat
1594968Ms4a5membrane spanning 4-domains A51227449923227457760Rat
727900Ms4a14membrane spanning 4-domains A141227471441227486953Rat
1305549Ms4a7membrane spanning 4-domains A71227490777227506819Rat
1307006Ms4a4amembrane spanning 4-domains A4A1227574789227606958Rat
2323335LOC100359806hypothetical LOC1003598061227610705227611202Rat
1583863Ms4a4cmembrane-spanning 4-domains, subfamily A, member 4C1227640732227663127Rat
1589849Ms4a6cmembrane-spanning 4-domains, subfamily A, member 6C1227668494227679008Rat
1590964LOC690870similar to Eukaryotic translation initiation factor 5 (eIF-5)1227683943227685963Rat
1590971LOC690862similar to membrane-spanning 4-domains, subfamily A, member 4C1227732711227750533Rat
6486317Ms4a6emembrane spanning 4-domains A6E1227757444227769336Rat
1311761Ms4a6bmembrane-spanning 4-domains, subfamily A, member 6B1227798183227818296Rat
7598744LOC102551452uncharacterized LOC1025514521227834025227844485Rat
1590996LOC690836similar to membrane-spanning 4-domains, subfamily A, member 4C1227892979227905374Rat
2323952LOC100362826hypothetical LOC1003628261227917050227918931Rat
1305800Ms4a6amembrane spanning 4-domains A6A1227919284227932637Rat
2598Ms4a2membrane spanning 4-domains A21227957363227965312Rat
1310598Ms4a3membrane spanning 4-domains A31227979307227994210Rat
1590948Oosp2oocyte secreted protein 21227998369228014956Rat
1590944Oosp1oocyte secreted protein 11228032363228058901Rat
62084Cblifcobalamin binding intrinsic factor1228118048228132296Rat
621005Stx3syntaxin 31228137781228195004Rat
735195Mrpl16mitochondrial ribosomal protein L161228142778228147590Rat
9469484LOC103691293uncharacterized LOC1036912931228188644228191563Rat
1593675Olr1874olfactory receptor 18741228225398228226959Rat
1584974LOC309220similar to mortality factor 4 like 1 isoform b1228227252228228511Rat
1334072Olr318olfactory receptor 3181228262242228263198Rat
1333276Olr319olfactory receptor 3191228317412228318341Rat
1305514Patl1PAT1 homolog 1, processing body mRNA decay factor1228337756228369719Rat
9107141LOC103691294uncharacterized LOC1036912941228382255228395447Rat
1308069Osbpoxysterol binding protein1228395237228425366Rat
11491306Trnaf-gaa1transfer RNA phenylalanine (anticodon GAA) 11228434808228434880Rat
11428976Trnak-uuu1transfer RNA lysine (anticodon UUU) 11228439662228439734Rat
11517460Trnaf-gaa2transfer RNA phenylalanine (anticodon GAA) 21228441628228441700Rat
11504103Trnak-uuu2transfer RNA lysine (anticodon UUU) 21228442932228443004Rat
11478896Trnal-uaa2transfer RNA leucine (anticodon UAA) 21228444446228444528Rat
11403555Trnar-ucu1transfer RNA arginine (anticodon UCU) 11228444948228445033Rat
11427576Trnav-uac1transfer RNA valine (anticodon UAC) 11228445276228445348Rat
11499330Trnav-uac2transfer RNA valine (anticodon UAC) 21228445616228445688Rat
2324714LOC100363176mCG145114-like1228450455228450949Rat
1333895Olr320-psolfactory receptor pseudogene 3201228456746228457572Rat
1334346Olr321olfactory receptor 3211228474340228475272Rat
1332621Olr322olfactory receptor 3221228504037228541080Rat
1333126Olr323olfactory receptor 3231228523504228524439Rat
1333150Olr324olfactory receptor 3241228536770228541239Rat
1333601Olr325olfactory receptor 3251228545913228546857Rat
1333796Olr326olfactory receptor 3261228557640228558593Rat
1334070Olr330olfactory receptor 3301228628274228629212Rat
1333015Olr337olfactory receptor 3371228684408228685364Rat
1564458Pfplpore forming protein-like1228686168228692950Rat
69275Mpeg1macrophage expressed 11228724559228729054Rat
1311767Dtx4deltex E3 ubiquitin ligase 41228729842228759783Rat
6499051LOC100910386protein FAM111A-like1228790111228822965Rat
1588627LOC691074hypothetical protein LOC6910741228966245228970914Rat
1560913Fam111aFAM111 trypsin like peptidase A1229003778229019532Rat
11373428LOC108349791glyceraldehyde-3-phosphate dehydrogenase pseudogene1229020859229021631Rat
1564894Glyatl1glycine-N-acyltransferase-like 11229039889229055127Rat
1307163Glyatglycine-N-acyltransferase1229060125229081113Rat
1591254LOC686967similar to olfactory receptor 14421229097399229103338Rat
1334154Olr338olfactory receptor 3381229107911229108849Rat
1305704RGD1305704similar to c-Mpl binding protein1229202475229206884Rat
11357405LOC10834927160S ribosomal protein L30-like1229219751229220133Rat
1303288Spink14serine peptidase inhibitor, Kazal type 141229349133229351168Rat
1333889Olr335-psolfactory receptor pseudogene 3351229399514229400394Rat
1333328Olr336olfactory receptor 3361229416489229417451Rat
1334079Olr334olfactory receptor 3341229443102229444043Rat
1332879Olr333-psolfactory receptor pseudogene 3331229454468229454982Rat
1333575Olr332olfactory receptor 3321229461127229462086Rat
1333238Olr331olfactory receptor 3311229480173229481119Rat
1333407Olr387olfactory receptor 3871229480184229481119Rat
621231Glyatl2glycine-N-acyltransferase-like 21229519586229552573Rat
2370Cntfciliary neurotrophic factor1229599009229601032Rat
628736Zfp91zinc finger protein 911229602499229640906Rat
1304981Lpxnleupaxin1229642437229674129Rat
1334091Olr339olfactory receptor 3391229722768229723727Rat
1333323Olr341olfactory receptor 3411229755371229765149Rat
1334063Olr340olfactory receptor 3401229755649229756593Rat
1332989Olr342-psolfactory receptor pseudogene 3421229783268229784188Rat
1334374Olr343olfactory receptor 3431229803670229804614Rat
1333125Olr344olfactory receptor 3441229824542229825477Rat
9464512LOC103691300olfactory receptor 5B2-like1229835018229835991Rat
1333625Olr346olfactory receptor 3461229849892229850818Rat
1333760Olr347olfactory receptor 3471229877560229878483Rat
1333475Olr348olfactory receptor 3481229889771229890694Rat
1334406Olr349olfactory receptor 3491229927014229927937Rat
1562884Cct7-ps1chaperonin containing Tcp1, subunit 7 (eta), pseudogene 11229937915229939784Rat
1332605Olr350-psolfactory receptor pseudogene 3501229961247229962178Rat
1334131Olr351-psolfactory receptor pseudogene 3511229991278229992242Rat
1332654Olr352olfactory receptor 3521230011125230012048Rat
1333991Olr353-psolfactory receptor pseudogene 3531230022471230022755Rat
1333250Olr354olfactory receptor 3541230030914230031867Rat
1333071Olr355-psolfactory receptor pseudogene 3551230035730230036611Rat
1332853Olr356-psolfactory receptor pseudogene 3561230042532230042726Rat
1333477Olr357olfactory receptor 3571230056710230057657Rat
1333912Olr358olfactory receptor 3581230078984230079916Rat
1333674Olr359-psolfactory receptor pseudogene 3591230093470230094427Rat
1333366Olr360olfactory receptor 3601230114354230118068Rat
1559854RGD1559854similar to ribosomal protein S81230119400230120050Rat
1586288LOC691216similar to transducer of ERBB2, 1b1230136308230137454Rat
1333423Olr361olfactory receptor 3611230160365230161297Rat
7576854LOC102551661olfactory receptor 5B3-like1230169579230170584Rat
1332962Olr362-psolfactory receptor pseudogene 3621230192423230193296Rat
9121299LOC103691301olfactory receptor 5B3-like1230207284230208225Rat
1590081LOC687088similar to olfactory receptor 14671230217215230218138Rat
1590077LOC687092similar to olfactory receptor Olr3631230234477230235409Rat
1334416Olr363olfactory receptor 3631230268991230269929Rat
1590072LOC687097similar to Olfactory receptor 5B2 (OST073) (Olfactory receptor OR11-240)1230297234230298178Rat
1332812Olr365olfactory receptor 3651230305923230306867Rat
1333508Olr366-psolfactory receptor pseudogene 3661230351973230352913Rat
1333483Olr367olfactory receptor 3671230377079230378014Rat
1333876Olr368-psolfactory receptor pseudogene 3681230391244230391741Rat
1334125Olr369-psolfactory receptor pseudogene 3691230415322230416264Rat
1333313Olr370-psolfactory receptor pseudogene 3701230433109230433961Rat
1333922Olr371olfactory receptor 3711230450529230451470Rat
1333289Olr372olfactory receptor 3721230521485230522435Rat
1334396Olr373olfactory receptor 3731230553486230554436Rat
1333050Olr374olfactory receptor 3741230576298230577254Rat
1586243LOC691268similar to Fatty acid-binding protein, epidermal (E-FABP) (Cutaneous fatty acid-binding protein) (C-FABP) (DA11)1230577443230577834Rat
1333045Olr375olfactory receptor 3751230604386230605345Rat
1333888Olr376olfactory receptor 3761230628996230629943Rat
2323522LOC100359718COP9 signalosome subunit 81230646291230646817Rat
1333595Olr377olfactory receptor 3771230648994230649938Rat
1333303Olr378olfactory receptor 3781230664467230665429Rat
1334108Olr379olfactory receptor 3791230674772230675707Rat
1333030Olr380olfactory receptor 3801230686210230687157Rat
1333317Olr381-psolfactory receptor pseudogene 3811230703707230704654Rat
1333288Olr382olfactory receptor 3821230729010230729954Rat
1333181Olr383olfactory receptor 3831230765568230766515Rat
1333930Olr384olfactory receptor 3841230811800230812750Rat
1626012Vom2r-ps69vomeronasal 2 receptor, pseudogene 691230835782230836123Rat
11423435LOC10834887060S ribosomal protein L21-like1231059426231059937Rat
1561986RGD1561986similar to RIKEN cDNA 3110001I221231364692231365645Rat
3868Tle4TLE family member 4, transcriptional corepressor1231394606231531396Rat
11404603LOC108349694uncharacterized LOC1083496941232519806232643562Rat
9347574LOC10369130360S ribosomal protein L31 pseudogene1232820492232820871Rat
6500484LOC100910059high mobility group protein B1-like1232897838232904124Rat
735170Psat1phosphoserine aminotransferase 11233124089233145941Rat
620464Cep78centrosomal protein 781233185815233214876Rat
7736515LOC102553402uncharacterized LOC1025534021233240086233259948Rat
9080106LOC10369130460S ribosomal protein L31 pseudogene1233302733233303131Rat
620770GnaqG protein subunit alpha q1233382778233622584Rat
1597112LOC365418similar to periodic tryptophan protein 1 homolog1233651060233654262Rat
1586523LOC687374hypothetical protein LOC6873741233774730233843877Rat
11474079LOC108349792glyceraldehyde-3-phosphate dehydrogenase pseudogene1234180062234186813Rat
1306778RorbRAR-related orphan receptor B1234252757234442597Rat
7658951LOC102554959uncharacterized LOC1025549591234272557234282266Rat
9342834LOC103691296uncharacterized LOC1036912961234288818234291852Rat
11463609LOC108349695uncharacterized LOC1083496951234288818234297404Rat
7654573LOC102554891uncharacterized LOC1025548911234327048234365360Rat
1309942Trpm6transient receptor potential cation channel, subfamily M, member 61234478908234631264Rat
11409360LOC108349696uncharacterized LOC1083496961234614791234620606Rat
7668904LOC102554711uncharacterized LOC1025547111234631999234639340Rat
7657298LOC102554783uncharacterized LOC1025547831234651157234660520Rat
1563237LOC499331similar to hypothetical protein D030056L221234665904234670113Rat
1311863Carnmt1carnosine N-methyltransferase 11234675442234704856Rat
1564687Nmrk1nicotinamide riboside kinase 11234721992234749452Rat
11475263LOC10834969740S ribosomal protein S15 pseudogene1234737382234738939Rat
628849Ostf1osteoclast stimulating factor 11234749568234796739Rat
1597038LOC499329similar to ribonucleic acid binding protein S11234927924234929233Rat
1308122Gna14G protein subunit alpha 141235165775235347986Rat
9463884LOC103691297eukaryotic translation initiation factor 2 subunit 2 pseudogene1235205309235209476Rat
1311340Vps13avacuolar protein sorting 13 homolog A1235352513235813597Rat
1585019Foxb2forkhead box B21235917300235918792Rat
620326Pcsk5proprotein convertase subtilisin/kexin type 51236031988236313858Rat
1549748Rfkriboflavin kinase1236494221236501733Rat
9261194LOC103691298acyl-protein thioesterase 1 pseudogene1236529758236530758Rat
621370Gcnt1glucosaminyl (N-acetyl) transferase 11236547729236585037Rat
11460326LOC108349698uncharacterized LOC1083496981236637162236640054Rat
9404555LOC103691299uncharacterized LOC1036912991236649625236660002Rat
1311350Prune2prune homolog 2 with BCH domain1236676963236947527Rat
7689479LOC102546963protein prune homolog 2-like1236883677236947150Rat
6494111LOC100911189fructose-bisphosphate aldolase A-like1237441138237442585Rat
2323439LOC100363201nucleophosmin 1-like1237560904237561831Rat
9136630LOC103691305transcription factor BTF3 homolog 4-like1237566660237575214Rat
1563931RGD1563931similar to basic transcription factor 31237574877237575252Rat
2118Anxa1annexin A11237893983237910002Rat
11359654LOC10834969960S ribosomal protein L17 pseudogene1238042544238045148Rat
2087Aldh1a1aldehyde dehydrogenase 1 family, member A11238222689238264381Rat
1308682Tmc1transmembrane channel-like 11238336919238525792Rat
7657219LOC102551351uncharacterized LOC1025513511238717144238759436Rat
11492063LOC108348874glyceraldehyde-3-phosphate dehydrogenase pseudogene1238792028238792460Rat
1310776Zfand5zinc finger AN1-type containing 51238842506238854030Rat
7618157LOC102551544uncharacterized LOC1025515441238869869238873182Rat
9142228LOC103691306uncharacterized LOC1036913061238870341238899230Rat
621617Gdaguanine deaminase1238982542239057663Rat
6490675LOC100911842uncharacterized LOC1009118421239150948239156067Rat
1359158RGD1359158similar to RIKEN cDNA 1110059E241239207869239265997Rat
1305246Abhd17babhydrolase domain containing 17B, depalmitoylase1239266140239301133Rat
11381164LOC108348948uncharacterized LOC1083489481239308739239321140Rat
9111077LOC103691307fatty acid-binding protein, epidermal pseudogene1239319167239319922Rat
1584793LOC679749similar to ribosomal protein S111239332832239333355Rat
1307941Cemip2cell migration inducing hyaluronidase 21239397322239474931Rat
7632678LOC102551900uncharacterized LOC1025519001239397488239406410Rat
1304888Trpm3transient receptor potential cation channel, subfamily M, member 31239741572240757583Rat
11411734LOC10834982160S ribosomal protein L17 pseudogene1239847790239848395Rat
9227186LOC103691308ubiquitin-conjugating enzyme E2 D2 pseudogene1239874432239876360Rat
11462102LOC108349822uncharacterized LOC1083498221240034613240038421Rat
6489406LOC100912018mitochondrial import inner membrane translocase subunit Tim23-like1240052911240061514Rat
11518304LOC108349823uncharacterized LOC1083498231240340056240347642Rat
7503291LOC102552001uncharacterized LOC1025520011240372711240384741Rat
2325551Mir204microRNA 2041240403000240403109Rat
620252Aldh1a7aldehyde dehydrogenase family 1, subfamily A71240584233240601843Rat
9265596LOC103691311uncharacterized LOC1036913111240759947240764054Rat
1561453RGD1561453similar to ribosomal protein S121240776538240777502Rat
11445681LOC108349100uncharacterized LOC1083491001240808272240831711Rat
9474149LOC103691312uncharacterized LOC1036913121240907030240908994Rat
70934Klf9Kruppel-like factor 91240908483240933198Rat
1307492Smc5structural maintenance of chromosomes 51240977898241046273Rat
1305129Mamdc2MAM domain containing 21241071110241223798Rat
9335366LOC103691318NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 11 pseudogene1241280663241282650Rat
1560242RGD1560242similar to RIKEN cDNA 1700028P141241338704241460868Rat
1564433RGD1564433similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12)1241466676241467020Rat
7599198LOC102554385glyceraldehyde-3-phosphate dehydrogenase-like1241473205241478465Rat
7692674LOC102554712uncharacterized LOC1025547121241477668241498888Rat
708369Ptar1protein prenyltransferase alpha subunit repeat containing 11241501679241557651Rat
620844Apba1amyloid beta precursor protein binding family A member 11241594565241796512Rat
1307524Fam189a2family with sequence similarity 189, member A21241822152241876089Rat
619807Tjp2tight junction protein 21241945816242084044Rat
1565754Fxnfrataxin1242123975242152834Rat
1310914Pip5k1bphosphatidylinositol-4-phosphate 5-kinase type 1 beta1242168462242441247Rat
7613404LOC102555386uncharacterized LOC1025553861242360611242448296Rat
1310316Pabir1PP2A Aalpha (PPP2R1A) and B55A (PPP2R2A) interacting phosphatase regulator 11242372458242373764Rat
1359349Tmem252transmembrane protein 2521242572558242577817Rat
1307969Pgm5phosphoglucomutase 51242582591242765837Rat
9183372LOC103691313histone H3.3-like1242760654242761282Rat
621716Foxd4forkhead box D41242808886242810186Rat
708495Cbwd1COBW domain containing 11242819383242861792Rat
7729455LOC102556915uncharacterized LOC1025569151242861859242871484Rat
1561588Dock8dedicator of cytokinesis 81242934685243153472Rat
9462182C1H9orf66chromosome 1 open reading frame, human C9orf661242958912242961750Rat
1596834Hmgb1-ps4high-mobility group box 1, pseudogene 41243107923243109335Rat
11474936LOC108349152uncharacterized LOC1083491521243184048243189000Rat
1307714Kank1KN motif and ankyrin repeat domains 11243201073243398531Rat
7600426LOC102554752uncharacterized LOC1025547521243299060243309760Rat
2323621LOC100359573RAN, member RAS oncogene family1243466921243467553Rat
621640Dmrt1doublesex and mab-3 related transcription factor 11243477403243582629Rat
1306043Dmrt3doublesex and mab-3 related transcription factor 31243589607243602926Rat
1309047Dmrt2doublesex and mab-3 related transcription factor 21243662819243669312Rat
11400155LOC108349212uncharacterized LOC1083492121243906623243915474Rat
9367821LOC103691314uncharacterized LOC1036913141243977808243979207Rat
9327776LOC103691315uncharacterized LOC1036913151244057932244068687Rat
11478594LOC108349233uncharacterized LOC1083492331244160361244204257Rat
7594231LOC102555110uncharacterized LOC1025551101244264352244272545Rat
9160927LOC103695057uncharacterized LOC1036950571244293162244312066Rat
1562774RGD1562774similar to proteasome (prosome, macropain) subunit, beta type 61244380581244381353Rat
9453920LOC103691317uncharacterized LOC1036913171244447065244452764Rat
11465647LOC108349293uncharacterized LOC1083492931244612142244617696Rat
1302988Smarca2SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 21244615811244783736Rat
9413911LOC103691324uncharacterized LOC1036913241244778795244779494Rat
11409422LOC108348917uncharacterized LOC1083489171244858784244860281Rat
7524986LOC102555475uncharacterized LOC1025554751244967275244968097Rat
6495932LOC10091093040S ribosomal protein S17-like1245013149245013549Rat
7599954LOC102557104uncharacterized LOC1025571041245078449245097663Rat
3963Vldlrvery low density lipoprotein receptor1245236819245273688Rat
7656472LOC102555714uncharacterized LOC1025557141245315715245359601Rat
9187932LOC103691325uncharacterized LOC1036913251245360302245370047Rat
1309271Kcnv2potassium voltage-gated channel modifier subfamily V member 21245396880245475011Rat
1564753Pum3pumilio RNA-binding family member 31245476400245517081Rat
7700759LOC102555808uncharacterized LOC1025558081245536381245544231Rat
11469170LOC108349357uncharacterized LOC1083493571245557810245559469Rat
7566943LOC102555989uncharacterized LOC1025559891245692004245736856Rat
2325049LOC100359682eukaryotic translation initiation factor 4E-like1245774492245774938Rat
1307779Rfx3regulatory factor X31245853332246110648Rat
7517961LOC102550663THO complex subunit 3-like1246067375246069573Rat
1589453LOC680623hypothetical protein LOC6806231246141856246143074Rat
1565505Glis3GLIS family zinc finger 31246380816246564385Rat
7628278LOC102556263uncharacterized LOC1025562631246572125246585195Rat
9270246LOC103691326uncharacterized LOC1036913261246599944246602237Rat
9425434LOC103691327uncharacterized LOC1036913271246623875246647311Rat
7711868LOC102550766phosphatidylethanolamine-binding protein 1-like1246697358246715710Rat
9459053LOC103691328uncharacterized LOC1036913281246736363246747100Rat
7715694LOC102546345uncharacterized LOC1025463451246926646246957559Rat
3696Slc1a1solute carrier family 1 member 11246955017247035159Rat
9458091LOC103691329uncharacterized LOC1036913291246986205246990035Rat
7615968LOC10254642960S ribosomal protein L27a-like1247004745247009551Rat
1310039Spata6lspermatogenesis associated 6-like1247037004247088124Rat
1566000Plpp6phospholipid phosphatase 61247084228247087080Rat
1588239LOC680727similar to Phytanoyl-CoA dioxygenase, peroxisomal precursor (Phytanoyl-CoA alpha-hydroxylase) (PhyH) (Phytanic acid oxidase)1247093572247094465Rat
1565057RGD1565057similar to hypothetical protein FLJ328711247094538247110187Rat
1309295Cdc37l1cell division cycle 37-like 11247110147247139113Rat
619885Ak3adenylate kinase 31247144486247169690Rat
1305320Rcl1RNA terminal phosphate cyclase-like 11247228012247272369Rat
2325609Mir101-2microRNA 101-21247263723247263819Rat
9204586LOC103691342dynein light chain 1, cytoplasmic-like1247316399247317650Rat
9148072LOC103691330uncharacterized LOC1036913301247327409247338211Rat
2939Jak2Janus kinase 21247398667247457521Rat
62061Insl6insulin-like 61247473292247476827Rat
7710008LOC102546806prohibitin-like1247476925247478758Rat
3579Rln1relaxin 11247483298247486331Rat
1306839Plgrktplasminogen receptor with a C-terminal lysine1247502274247514540Rat
1566211Cd274CD274 molecule1247519890247539659Rat
1585881LOC680908hypothetical protein LOC6809081247555732247556767Rat
1306403Pdcd1lg2programmed cell death 1 ligand 21247562202247629279Rat
7691232LOC102547032uncharacterized LOC1025470321247563467247571662Rat
1310016Ric1RIC1 homolog, RAB6A GEF complex partner 11247688778247784219Rat
727831Ermp1endoplasmic reticulum metallopeptidase 11247784830247821771Rat
1306525Mlanamelan-A1247869756247883558Rat
1311595RGD1311595similar to KIAA2026 protein1247898572247978661Rat
11481274LOC10834943360S ribosomal protein L7a pseudogene1247950796247951597Rat
1305165Ranbp6RAN binding protein 61247980976247985553Rat
1597109LOC365444similar to CGI-09 protein1248045504248047696Rat
1311155Il33interleukin 331248112611248147030Rat
1309391Tpd52l3TPD52 like 31248187429248202090Rat
1584666LOC681078similar to eukaryotic translation elongation factor 1 beta 21248213209248213965Rat
1309990Uhrf2ubiquitin like with PHD and ring finger domains 21248228496248291984Rat
1308660Gldcglycine decarboxylase1248295140248377122Rat
2319280LOC100361898coiled-coil-helix-coiled-coil-helix domain containing 41248402889248403604Rat
6491645LOC100911648cytochrome c, somatic-like1248410762248411746Rat
2322594LOC100363655hypothetical LOC1003636551248413707248414125Rat
67380Mbl2mannose binding lectin 21248435069248442669Rat
7719645LOC102550442uncharacterized LOC1025504421248456663248473355Rat
7609152LOC102547321uncharacterized LOC1025473211248475588248478227Rat
7556391LOC102547391uncharacterized LOC1025473911248482090248500831Rat
9412148LOC103691331uncharacterized LOC1036913311248650422248657752Rat
1307313Dkk1dickkopf WNT signaling pathway inhibitor 11248952896248956579Rat
6488889LOC100912050dickkopf-related protein 1-like1248953733248956766Rat
1587390Prkg1protein kinase cGMP-dependent 11248982039250300952Rat
1310026Cstf2tcleavage stimulation factor subunit 2, tau variant1249574954249578520Rat
9368735LOC103691332uncharacterized LOC1036913321249879846249884246Rat
9141659LOC103691333uncharacterized LOC1036913331250094795250101686Rat
9301607LOC103691334uncharacterized LOC1036913341250373232250424935Rat
619834A1cfAPOBEC1 complementation factor1250426027250514245Rat
69410Asah2N-acylsphingosine amidohydrolase 21250557042250665083Rat
9232286LOC103691335uncharacterized LOC1036913351250663536250665089Rat
727912Sgms1sphingomyelin synthase 11250692448250951685Rat
1598008Nutf2-ps1nuclear transport factor 2, pseudogene 11250987619250989483Rat
1597998LOC681274similar to cytokine induced apoptosis inhibitor 11251004380251005426Rat
3089Minpp1multiple inositol-polyphosphate phosphatase 11251045352251071045Rat
9231931LOC103691336uncharacterized LOC1036913361251058647251060040Rat
1307012Papss23'-phosphoadenosine 5'-phosphosulfate synthase 21251145264251230716Rat
1308570Atad1ATPase family, AAA domain containing 11251234702251386996Rat
1596474Cyp2b15cytochrome P450, family 2, subfamily b, polypeptide 151251325923251338404Rat
7716028LOC102547813glutathione S-transferase P 1-like1251386355251387002Rat
7720631Kllnkillin, p53-regulated DNA replication inhibitor1251417849251420794Rat
61995Ptenphosphatase and tensin homolog1251421814251487634Rat
9224583LOC103691338uncharacterized LOC1036913381251452441251453318Rat
1565695RGD1565695similar to Aldo-keto reductase family 1, member B81251599687251600674Rat
7552279LOC102547905uncharacterized LOC1025479051251616202251624210Rat
9404564LOC10369134460S ribosomal protein L29 pseudogene1251666695251667135Rat
7659550LOC102548095uncharacterized LOC1025480951251757238251791001Rat
9283963LOC103691339uncharacterized LOC1036913391251821679251828240Rat
1309804Rnlsrenalase, FAD-dependent amine oxidase1251828285252101963Rat
7666330Rps4x-ps1ribosomal protein S4, X-linked, pseudogene 11252001218252002505Rat
1565682Lipo1lipase, member O11252102233252117030Rat
2321667LOC100360690tear acid-lipase-like protein-like1252154610252167791Rat
708441Lipflipase F, gastric type1252284464252302811Rat
1309724Lipklipase, family member K1252323865252355893Rat
1560354Lipnlipase, family member N1252375941252394226Rat
1304912Lipmlipase, family member M1252409232252428567Rat
1307862Ankrd22ankyrin repeat domain 221252430750252461346Rat
9259818LOC103691340uncharacterized LOC1036913401252473362252479907Rat
9340674LOC103691345uncharacterized LOC1036913451252487182252497528Rat
1583011Stambpl1STAM binding protein-like 11252490125252536113Rat
621676Acta2actin alpha 2, smooth muscle1252537614252550394Rat
1597562LOC687722similar to death effector domain-containing1252555638252557801Rat
619831FasFas cell surface death receptor1252589785252624790Rat
1310575Ch25hcholesterol 25-hydroxylase1252807062252811409Rat
3008Lipalipase A, lysosomal acid type1252816536252959348Rat
1307804Ifit2interferon-induced protein with tetratricopeptide repeats 21252894663252900727Rat
1359681Ifit3interferon-induced protein with tetratricopeptide repeats 31252906234252911377Rat
1304872Ifit1blinterferon-induced protein with tetratricopeptide repeats 1B-like1252914684252959348Rat
620599Ifit1interferon-induced protein with tetratricopeptide repeats 11252944105252946170Rat
1311468Slc16a12solute carrier family 16, member 121252976071253054500Rat
9326603LOC10369134160S ribosomal protein L36a-like1252990025252993575Rat
1304677Pank1pantothenate kinase 11253115400253189643Rat
2325578Mir107microRNA 1071253128250253128336Rat
7526703LOC102549070uncharacterized LOC1025490701253210721253219953Rat
1308497Kif20bkinesin family member 20B1253220038253275523Rat
1596451Ears2l1glutamyl-tRNA synthetase 2-like 11253296528253303851Rat
1596438LOC685259similar to Proteasome subunit alpha type 5 (Proteasome zeta chain) (Macropain zeta chain) (Multicatalytic endopeptidase complex zeta chain)1253375594253376315Rat
2322962LOC100363483hypothetical LOC1003634831253423508253424429Rat
6498974LOC100910377negative elongation factor E-like1253840054253842433Rat
1595146LOC685302similar to initiation factor 2 associated 67 kDa protein1254018298254020446Rat
71034Htr75-hydroxytryptamine receptor 71254547964254671811Rat
11385874LOC108353431glyceraldehyde-3-phosphate dehydrogenase pseudogene1254620547254622571Rat
1595116Rpp30ribonuclease P/MRP subunit p301254697247254720093Rat
9362350LOC103691348uncharacterized LOC1036913481254719531254722216Rat
61989Ankrd1ankyrin repeat domain 11254726985254745673Rat
1583513Pcgf5polycomb group ring finger 51254974688255090925Rat
9313887LOC103691356myosin heavy chain IB-like1255039890255042229Rat
9179158LOC103691349uncharacterized LOC1036913491255136794255140626Rat
1305536Hectd2HECT domain E3 ubiquitin protein ligase 21255186729255254307Rat
1309132Ppp1r3cprotein phosphatase 1, regulatory subunit 3C1255371830255376833Rat
7595572LOC102553702uncharacterized LOC1025537021255416510255422595Rat
7509876LOC102553965uncharacterized LOC1025539651255451805255478762Rat
1305026Tnks2tankyrase 21255478794255532143Rat
1560326Fgfbp3fibroblast growth factor binding protein 31255555050255557055Rat
1564130Btaf1B-TFIID TATA-box binding protein associated factor 11255564247255654932Rat
1598012Rps27a-ps28ribosomal protein S27a, pseudogene 281255572800255573415Rat
1564670Cpeb3cytoplasmic polyadenylation element binding protein 31255660165255842671Rat
9175407LOC103691350uncharacterized LOC1036913501255717568255721178Rat
11499329LOC10834946060S ribosomal protein L35 pseudogene1255801789255802228Rat
1305617Marchf5membrane associated ring-CH-type finger 51255842642255864131Rat
7732471LOC102549247uncharacterized LOC1025492471255889861255903036Rat
2861Ideinsulin degrading enzyme1255914465256014168Rat
9162742LOC103691353uncharacterized LOC1036913531255940942255942293Rat
9331217LOC103691352uncharacterized LOC1036913521255996355256000981Rat
621258Kif11kinesin family member 111256035866256088299Rat
619932Hhexhematopoietically expressed homeobox1256101994256107581Rat
3653Exoc6exocyst complex component 61256211879256369318Rat
1308843Cyp26c1cytochrome P450, family 26, subfamily C, polypeptide 11256369410256380649Rat
7597238LOC102549441uncharacterized LOC1025494411256380747256382689Rat
620161Cyp26a1cytochrome P450, family 26, subfamily a, polypeptide 11256382861256386729Rat
1562542RGD1562542similar to ribosomal protein S121256453566256454005Rat
1564216Myofmyoferlin1256585410256734727Rat
6492554LOC100911555uncharacterized LOC1009115551256703104256712926Rat
11512881LOC108349463uncharacterized LOC1083494631256734951256738238Rat
1305340Cep55centrosomal protein 551256745251256760794Rat
1308252Ffar4free fatty acid receptor 41256786124256804156Rat
3546Rbp4retinol binding protein 41256806476256813678Rat
1309844Pde6cphosphodiesterase 6C1256822099256885879Rat
1309482Fra10ac1FRA10A associated CGG repeat 11256881688256913617Rat
1561251RGD1561251RGD15612511256926672256955504Rat
628742Lgi1leucine-rich, glioma inactivated 11256955944256996835Rat
9342409LOC103691354uncharacterized LOC1036913541256962461256964142Rat
1595908Slc35g1solute carrier family 35, member G11257076221257082655Rat
9108925LOC103691355uncharacterized LOC1036913551257126231257127758Rat
69424Plce1phospholipase C, epsilon 11257156023257465440Rat
7536824LOC102550070selenide, water dikinase 1-like1257221456257223298Rat
1560656Noc3lNOC3-like DNA replication regulator1257469538257498844Rat
9377071Tbc1d12TBC1 domain family, member 121257517128257599659Rat
11437438LOC10834946560S ribosomal protein L35a pseudogene1257618585257618956Rat
1587819LOC685956similar to 60S ribosomal protein L27a1257674502257675008Rat
2469Cyp2c11cytochrome P450, subfamily 2, polypeptide 111257676172258004428Rat
6490344LOC100911914TBC1 domain family member 12-like1257693860257750281Rat
6489920LOC100911964lymphoid-specific helicase-like1257766289257767881Rat
1587841LOC685933hypothetical protein LOC6859331257828474257885689Rat
1309820Hellshelicase, lymphoid specific1257901856257953889Rat
11388886LOC10834825860S ribosomal protein L27a pseudogene1257966995257967501Rat
1563697Cyp2c24cytochrome P450, family 2, subfamily c, polypeptide 241258074797258139176Rat
11472032LOC108349703uncharacterized LOC1083497031258128249258132013Rat
11406254LOC10834910440S ribosomal protein S8 pseudogene1258164137258164751Rat
2320073LOC100361492cytochrome P450, family 2, subfamily c, polypeptide 55-like1258210311258252829Rat
6488119LOC100912265cytochrome P450 2C26-like1258283655258299904Rat
11432159LOC10834979360S ribosomal protein L19 pseudogene1258451003258451523Rat
11388186LOC108349865endogenous retrovirus group K member 9 Pol protein-like1258689025258690959Rat
2470Cyp2c12cytochrome P450, family 2, subfamily c, polypeptide 121258709726258766873Rat
620363Cyp2c13cytochrome P450, family 2, subfamily c, polypeptide 131258796624258877023Rat
9347575LOC103691358uncharacterized LOC1036913581258951780259013819Rat
9071809LOC103691359uncharacterized LOC1036913591259026391259030660Rat
6486355LOC100912575heterogeneous nuclear ribonucleoproteins C1/C2-like1259107045259111745Rat
620368Cyp2c22cytochrome P450, family 2, subfamily c, polypeptide 221259257658259297270Rat
68324Pdlim1PDZ and LIM domain 11259308326259357006Rat
1586598Sorbs1sorbin and SH3 domain containing 11259373921259502108Rat
7640229LOC102555231uncharacterized LOC1025552311259601374259608411Rat
9380289LOC103691360uncharacterized LOC1036913601259608856259613125Rat
1311431Aldh18a1aldehyde dehydrogenase 18 family, member A11259641673259674521Rat
1305166Tctn3tectonic family member 31259681435259691881Rat
69265Entpd1ectonucleoside triphosphate diphosphohydrolase 11259692020259818922Rat
9168414LOC103690185protein CC2D2B-like1259877874259924270Rat
6502175LOC100909771cyclin-J-like1259926502259944275Rat
1306399Ccnjcyclin J1259926537259944275Rat
1310408Cc2d2bcoiled-coil and C2 domain containing 2B1259998744260092810Rat
9408752LOC103690184protein CC2D2B-like1260047830260090655Rat
9323181LOC103691361uncharacterized LOC1036913611260095481260097433Rat
1305314Zfp518azinc finger protein 518A1260152881260178360Rat
1561933BlnkB-cell linker1260187023260254490Rat
1305054DnttDNA nucleotidylexotransferase1260289626260321174Rat
1307776Opalinoligodendrocytic myelin paranodal and inner loop protein1260324028260341677Rat
1559756Tll2tolloid-like 21260348905260460791Rat
1564625Tm9sf3transmembrane 9 superfamily member 31260464935260517997Rat
1307744Pik3ap1phosphoinositide-3-kinase adaptor protein 11260527344260679132Rat
9123563LOC103691362uncharacterized LOC1036913621260644078260679466Rat
9138968LOC103691363uncharacterized LOC1036913631260741281260744816Rat
1311704Lcorligand dependent nuclear receptor corepressor1260775091260839549Rat
1311704Lcorligand dependent nuclear receptor corepressor1260789955260809051Rat
69307Slit1slit guidance ligand 11260843481260992366Rat
7551642LOC102553433uncharacterized LOC1025534331260946538260949494Rat
1593044Arhgap19Rho GTPase activating protein 191261015083261051515Rat
7718071LOC102553733uncharacterized LOC1025537331261061158261070305Rat
9327785LOC103691372NAD-dependent protein deacetylase HST1-like1261070320261070926Rat
9147096Frat1FRAT regulator of WNT signaling pathway 11261071965261075244Rat
1591882Frat2FRAT regulator of WNT signaling pathway 21261088504261091690Rat
1591867Rrp12ribosomal RNA processing 12 homolog1261106768261140416Rat
3312Pgam1phosphoglycerate mutase 11261158204261165814Rat
1591855Exosc1exosome component 11261169798261179865Rat
1591893Zdhhc16zinc finger DHHC-type palmitoyltransferase 161261179971261191374Rat
727890Mms19MMS19 homolog, cytosolic iron-sulfur assembly component1261191646261229070Rat
1308172Ubtd1ubiquitin domain containing 11261229347261280543Rat
1305104Ankrd2ankyrin repeat domain 21261281859261291307Rat
1310475Hoga14-hydroxy-2-oxoglutarate aldolase 11261291742261319743Rat
1588156MGC93861hypothetical protein LOC6820101261298147261299506Rat
1307336Morn4MORN repeat containing 41261323079261333383Rat
620485Pi4k2aphosphatidylinositol 4-kinase type 2 alpha1261337594261362509Rat
621721Avpi1arginine vasopressin-induced 11261365590261371519Rat
7605594LOC102554176uncharacterized LOC1025541761261374508261375392Rat
1309811Marveld1MARVEL domain containing 11261389804261393736Rat
735177Zfyve27zinc finger FYVE-type containing 271261415172261438539Rat
1310369Sfrp5secreted frizzled-related protein 51261442108261446570Rat
1563029RGD1563029similar to RIKEN cDNA 1110007C051261463873261464753Rat
7501631LOC102547392uncharacterized LOC1025473921261483606261494438Rat
1583839Golga7bgolgin A7 family, member B1261494511261514413Rat
4888610Mir3085microRNA 30851261524235261524323Rat
621085Crtac1cartilage acidic protein 11261527009261669614Rat
1307934R3hcc1lR3H domain and coiled-coil containing 1-like1261753295261833437Rat
1308588Loxl4lysyl oxidase-like 41261833365261853599Rat
7613689LOC102547572uncharacterized LOC1025475721261866307261881482Rat
1303232Pyroxd2pyridine nucleotide-disulphide oxidoreductase domain 21261961164261987029Rat
69193Hps1HPS1, biogenesis of lysosomal organelles complex 3 subunit 11261989178262015282Rat
11367759LOC108349471uncharacterized LOC1083494711262015314262048527Rat
1307959Hpse2heparanase 2 (inactive)1262020903263138299Rat
7554188LOC102554961TD and POZ domain-containing protein 4-like1262053105262054455Rat
7546946LOC102555060serine/threonine-protein kinase PAK 1-like1262222803262225604Rat
1308728Cnnm1cyclin and CBS domain divalent metal cation transport mediator 11263184361263243912Rat
2721Got1glutamic-oxaloacetic transaminase 11263246248263269762Rat
7733544LOC102546432uncharacterized LOC1025464321263269851263280158Rat
11405755LOC108349705uncharacterized LOC1083497051263300517263304589Rat
9194624LOC103691364uncharacterized LOC1036913641263317752263321171Rat
1308521Nkx2-3NK2 homeobox 31263361238263371043Rat
1584155Slc25a28solute carrier family 25 member 281263420039263431312Rat
1310638Entpd7ectonucleoside triphosphate diphosphohydrolase 71263448633263490308Rat
1312043Cox15cytochrome c oxidase assembly homolog COX151263494850263511510Rat
1304966CutccutC copper transporter1263511537263526308Rat
7555190LOC102546509cystatin-B-like1263551882263552620Rat
2366Abcc2ATP binding cassette subfamily C member 21263554426263612556Rat
1583840Dnmbpdynamin binding protein1263625503263718784Rat
70931Cpn1carboxypeptidase N subunit 11263733887263762758Rat
7598394LOC102554493casein kinase II subunit alpha'-like1263753577263755946Rat
620370Cyp2c23cytochrome P450, family 2, subfamily c, polypeptide 231263778510263803166Rat
1307058Erlin1ER lipid raft associated 11263810439263845762Rat
1306661Chukcomponent of inhibitor of nuclear factor kappa B kinase complex1263848829263884354Rat
1304716Cwf19l1CWF19 like cell cycle control factor 11263887014263910251Rat
1306551Bloc1s2biogenesis of lysosomal organelles complex-1, subunit 21263913901263920989Rat
1306261Pkd2l1polycystin 2 like 1, transient receptor potential cation channel1263922201263959318Rat
1595370LOC681458similar to stearoyl-coenzyme A desaturase 31263968156264003991Rat
11479482LOC108349475uncharacterized LOC1083494751264054092264057779Rat
621177Scd2stearoyl-Coenzyme A desaturase 21264059374264072433Rat
1563648Scd4stearoyl-coenzyme A desaturase 41264094007264105473Rat
621176Scdstearoyl-CoA desaturase1264159966264173061Rat
1307644Wnt8bWnt family member 8B1264244150264266136Rat
1598329Sec31bSEC31 homolog B, COPII coat complex component1264266279264294687Rat
1309129Ndufb8NADH:ubiquinone oxidoreductase subunit B81264298671264303712Rat
1308281Hif1anhypoxia inducible factor 1 subunit alpha inhibitor1264309214264319269Rat
7716077LOC102548668uncharacterized LOC1025486681264487949264490041Rat
1305568Pax2paired box 21264493579264585073Rat
2323148LOC100363396hypothetical LOC1003633961264609753264610014Rat
1560300Slf2SMC5-SMC6 complex localization factor 21264670836264733465Rat
11484603LOC10834948160S ribosomal protein L21 pseudogene1264705925264706476Rat
1310436Sema4gsemaphorin 4G1264738935264753399Rat
1307593Mrpl43mitochondrial ribosomal protein L431264755537264756404Rat
1307884Twnktwinkle mtDNA helicase1264756060264762892Rat
1359249Lzts2leucine zipper tumor suppressor 21264765256264776553Rat
1309882Pdzd7PDZ domain containing 71264776393264796206Rat
620716Sfxn3sideroflexin 31264796671264805159Rat
1310698Kazald1Kazal-type serine peptidase inhibitor domain 11264827739264831152Rat
7687782LOC102548859uncharacterized LOC1025488591264880879264892873Rat
1563655Tlx1T-cell leukemia, homeobox 11264893033264899424Rat
7597255LOC102548928uncharacterized LOC1025489281264940387264948784Rat
1564197Lbx1ladybird homeobox 11264973315264975132Rat
7603051LOC102549072uncharacterized LOC1025490721265030882265044870Rat
6490543LOC100911827uncharacterized LOC1009118271265071997265080010Rat
1359721Btrcbeta-transducin repeat containing E3 ubiquitin protein ligase1265100094265270263Rat
11497425LOC108349487uncharacterized LOC1083494871265279378265281982Rat
1308053PollDNA polymerase lambda1265290337265298847Rat
1307648Dpcddeleted in primary ciliary dyskinesia1265298872265318521Rat
1306518Fbxw4F-box and WD repeat domain containing 41265318526265420503Rat
7555446LOC102549941uncharacterized LOC1025499411265421017265429755Rat
7573700LOC102550220uncharacterized LOC1025502201265474208265487481Rat
9384142LOC103691365uncharacterized LOC1036913651265476474265478031Rat
70891Fgf8fibroblast growth factor 81265492949265498965Rat
9306095LOC103691366uncharacterized LOC1036913661265494377265496739Rat
1565542Npm3nucleophosmin/nucleoplasmin, 31265504105265506080Rat
621077OgaO-GlcNAcase1265506752265542452Rat
70887Kcnip2potassium voltage-gated channel interacting protein 21265549610265573393Rat
9299787Armh3armadillo-like helical domain containing 31265574715265757254Rat
631341Hps6HPS6, biogenesis of lysosomal organelles complex 2 subunit 31265761818265764427Rat
1310359Ldb1LIM domain binding 11265772729265798442Rat
1309688Pprc1PPARG related coactivator 11265809892265826319Rat
621578Nolc1nucleolar and coiled-body phosphoprotein 11265829055265839819Rat
1307263Elovl3ELOVL fatty acid elongase 31265883353265887181Rat
3332Pitx3paired-like homeodomain 31265886766265899947Rat
2324796LOC100363093ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G-like1265902780265903218Rat
1307160Gbf1golgi brefeldin A resistant guanine nucleotide exchange factor 11265904616266033107Rat
7653319LOC10255138960S ribosomal protein L19-like1266035428266036119Rat
7672409LOC102551485uncharacterized LOC1025514851266047785266050163Rat
1307189Nfkb2nuclear factor kappa B subunit 21266050634266059277Rat
620297Psdpleckstrin and Sec7 domain containing1266059331266074774Rat
1306444Fbxl15F-box and leucine-rich repeat protein 151266075782266078023Rat
1308096Cuedc2CUE domain containing 21266078107266087057Rat
2314885Mir146bmicroRNA 146b1266089488266089575Rat
9075175LOC103691367uncharacterized LOC1036913671266096372266098154Rat
1309313Mfsd13amajor facilitator superfamily domain containing 13A1266097293266122359Rat
1307025Actr1aactin related protein 1A1266123864266142621Rat
1559462SufuSUFU negative regulator of hedgehog signaling1266143766266241742Rat
11467223LOC108349509uncharacterized LOC1083495091266246449266251754Rat
1585223Trim8tripartite motif-containing 81266255797266270694Rat
69327Arl3ADP ribosylation factor like GTPase 31266287015266333099Rat
11364924LOC108349707uncharacterized LOC1083497071266287294266294060Rat
9404069LOC103691368uncharacterized LOC1036913681266301099266302384Rat
1306131Sfxn2sideroflexin 21266333440266345736Rat
1305793Wbp1lWW domain binding protein 1-like1266358728266415296Rat
2456Cyp17a1cytochrome P450, family 17, subfamily a, polypeptide 11266422127266429947Rat
1311783Borcs7BLOC-1 related complex subunit 71266451021266464903Rat
621325As3mtarsenite methyltransferase1266482787266514570Rat
9211952LOC103691369uncharacterized LOC1036913691266515464266524110Rat
1308162Cnnm2cyclin and CBS domain divalent metal cation transport mediator 21266530421266651292Rat
9459060LOC103691370uncharacterized LOC1036913701266555929266557592Rat
2323387Nt5c25'-nucleotidase, cytosolic II1266652966266782935Rat
11360257Trnar-ucu2transfer RNA arginine (anticodon UCU) 21266770684266770756Rat
2911Inainternexin neuronal intermediate filament protein, alpha1266782835266794389Rat
1306904Pcgf6polycomb group ring finger 61266811418266831022Rat
1311332Taf5TATA-box binding protein associated factor 51266844480266859965Rat
631426Atp5mkATP synthase membrane subunit k1266859961266866753Rat
1304933Pdcd11programmed cell death 111266866931266908042Rat
1308276Calhm2calcium homeostasis modulator family member 21266908367266914093Rat
1564891Calhm1calcium homeostasis modulator 11266916312266919031Rat
1560215Calhm3calcium homeostasis modulator 31266928596266935678Rat
1307021Neurl1neuralized E3 ubiquitin protein ligase 11266953006267038879Rat
11435417LOC108349530uncharacterized LOC1083495301267009287267013687Rat
1311185Sh3pxd2aSH3 and PX domains 2A1267039654267245868Rat
7669753LOC102552122uncharacterized LOC1025521221267075547267088515Rat
11459736LOC10834986660S ribosomal protein L17 pseudogene1267266451267267020Rat
1305637Stn1STN1 subunit of CST complex1267281786267315714Rat
11516962LOC108349533uncharacterized LOC1083495331267282064267285408Rat
11396518LOC10834979440S ribosomal protein S8 pseudogene1267349529267350766Rat
3780SlkSTE20-like kinase1267359761267415735Rat
1311130Col17a1collagen type XVII alpha 1 chain1267416681267465049Rat
9454647LOC103691371uncharacterized LOC1036913711267440213267474903Rat
1305481Sfr1SWI5-dependent homologous recombination repair protein 11267505336267509350Rat
1560545Cfap43cilia and flagella associated protein 431267511359267598642Rat
11454345LOC10834979540S ribosomal protein S12 pseudogene1267603904267604344Rat
70952Gsto1glutathione S-transferase omega 11267607437267617387Rat
1310764Gsto2glutathione S-transferase omega 21267617517267640455Rat
6488464Itpripinositol 1,4,5-trisphosphate receptor interacting protein1267649385267673341Rat
7656374Cfap58l1cilia and flagella associated protein 58-like 11267689258267798291Rat
11516969LOC10834970860S ribosomal protein L21 pseudogene1267710950267711513Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)1267917405267917477Rat
11514905Trnak-cuu1transfer RNA lysine (anticodon CUU) 11267917405267917477Rat
1310974Sorcs3sortilin-related VPS10 domain containing receptor 31267986305268620331Rat
11496109Trnak-cuu2transfer RNA lysine (anticodon CUU) 21268204746268204818Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)1268204746268204818Rat
7747426LOC102553376uncharacterized LOC1025533761268770344268785318Rat
7531295LOC102553570uncharacterized LOC1025535701269052718269087074Rat
1561154RGD1561154similar to heat shock protein 81269557669269559633Rat
2322523LOC100360227hypothetical LOC1003602271269893427269894045Rat
7579721LOC102554215uncharacterized LOC1025542151269907893269938795Rat
1305910Sorcs1sortilin-related VPS10 domain containing receptor 11269965824270473097Rat
7651693LOC102554335uncharacterized LOC1025543351270529674270547757Rat
1596933LOC678751similar to CWF19-like 2, cell cycle control1271193668271194787Rat
6488464Itpripinositol 1,4,5-trisphosphate receptor interacting protein1271252447271272169Rat
4888614Mir3584microRNA 35841271275895271275975Rat
1307961Cfap58cilia and flagella associated protein 581271292320271400675Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)1271565594271565666Rat
11483950Trnak-cuu3transfer RNA lysine (anticodon CUU) 31271565594271565666Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)1271647641271647713Rat
11430725Trnak-cuu4transfer RNA lysine (anticodon CUU) 41271647641271647713Rat
6502475LOC100909704coiled-coil domain-containing protein 147-like1271763617271771777Rat
2321699LOC100360658erythropoietin 4 immediate early response1272163273272164720Rat
1587125LOC679558hypothetical protein LOC6795581272373585272374719Rat
1587108LOC679575similar to nucleoporin 1331272635442272638628Rat
2915Ins1insulin 11272799784272800351Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2316896Gluco57Glucose level QTL 577.2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1249607907266793958Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1156446196243311614Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1215828102260828102Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1216324817261324817Rat
631669Iddm9Insulin dependent diabetes mellitus QTL 92.80.039blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1252955158280632620Rat
631690Scl5Serum cholesterol level QTL 52.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1258132568282763074Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1197963658242963658Rat
6480773Gluco64Glucose level QTL 645.09blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1217054291218614387Rat
6480777Insul17Insulin level QTL 173.86blood insulin amount (VT:0001560)blood insulin level area under curve (AUC) (CMO:0000351)1215097781216213510Rat
6480780Insul18Insulin level QTL 184.11blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1206950905218614387Rat
6480783Insul19Insulin level QTL 194.33blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1215494321218614387Rat
6480786Bw97Body weight QTL 975.03body mass (VT:0001259)body weight (CMO:0000012)1245529606248013094Rat
5508828Leukc3Leukocyte quantity QTL 3eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)1238220189244401301Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1197187728238220385Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1100131562236763528Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1241482188281795785Rat
8693618Alc25Alcohol consumption QTL 2530.28drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)1227509470249252048Rat
8693661Alc34Alcohol consumption QTL 342.20.611drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)1227509470249252048Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1202571665264802994Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1122614824262664716Rat
8693637Alc29Alcohol consumption QTL 292.70.258drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)1227509470255131140Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1191825895279986079Rat
631836Stl31Serum triglyceride level QTL 314.640.00000487blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1259295704282763074Rat
631837Niddm35Non-insulin dependent diabetes mellitus QTL 350.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1258709726281795785Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1205195290250195290Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1244401175282365384Rat
634312Bp143Blood pressure QTL 14330.0002arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1198446729240017341Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1193968438261264776Rat
634338Hcar4Hepatocarcinoma resistance QTL 44.6liver integrity trait (VT:0010547)liver tumorous lesion number to liver area ratio (CMO:0001210)1210960636236763528Rat
634340Hcar5Hepatocarcinoma resistance QTL 58liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1236763415247065599Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1144634295241482368Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1125875758262433692Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1210652654255652654Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221901238266901238Rat
7387289Uae45Urinary albumin excretion QTL 452.860.0021urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1244148899282763074Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1249206242281795785Rat
1300145Rf7Renal function QTL 72.96urine creatinine amount (VT:0010540)urine creatinine level (CMO:0000125)1201146802241482368Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1202571665264802994Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1242302911282763074Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210990171255990171Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)135377692217372257Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1194872362239872362Rat
1331790Bp201Blood pressure QTL 2013.127arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1216213318245529710Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1167394665278228889Rat
1300168Bp170Blood pressure QTL 1702.76arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1227107736249206417Rat
1302787Stl25Serum triglyceride level QTL 252.70.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1197187728230420772Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1225689973270689973Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1108986301219232156Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1108986301238830534Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1108986301219232156Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1167394665219232156Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1161784169219232156Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1192639698278228889Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1161784169219232156Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1161784169219232156Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1161784169278228889Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1192639698278228889Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1185390068230390068Rat
1359018Hrtrt20Heart rate QTL 203.08heart pumping trait (VT:2000009)heart rate (CMO:0000002)1201358068221983732Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1163796316282763074Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1210360774264802828Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1161784422246226103Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1230420627282645769Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1208517798266948272Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1190282646235282646Rat
1358292Cm37Cardiac mass QTL 376.20.00000081heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1216324817261324817Rat
1581544Rf52Renal function QTL 520.05total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1252948438281795785Rat
1598821Rf55Renal function QTL 556.3renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1238824734279986079Rat
1598839Rf56Renal function QTL 56renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1266793821279986079Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1153834077232297227Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1195598053265002735Rat
1600390Niddm64Non-insulin dependent diabetes mellitus QTL 640.003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1268570074269078983Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1244087148282763074Rat
1600399Niddm65Non-insulin dependent diabetes mellitus QTL 650.004blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1269633949270137485Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1161321256273791893Rat
1578778Pur4Proteinuria QTL 43.30.003total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1161321256273791893Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1236265430281265430Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1175462885220462885Rat
61400Niddm1Non-insulin dependent diabetes mellitus QTL 111blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1238830408266793958Rat
61403Niddm4Non-insulin dependent diabetes mellitus QTL 4blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1225689973247836969Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)199983293216325819Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1236795785281795785Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1174905700264802994Rat
2292222Bp307Blood pressure QTL 3073.060.0014arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1174905700233490237Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1198655722244992610Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1126240667217054291Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1193220385238220385Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1245529606282763074Rat
631260Tcas2Tongue tumor susceptibility QTL 24.93tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)1210019247217054418Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1161321152273792054Rat
724533Rf51Renal function QTL 515.30.0002kidney plasma flow trait (VT:0005524)renal plasma flow (CMO:0001914)1238830534278228767Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1243272341282763074Rat
724562Rends1Renal damage susceptibility QTL 10.05kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)1137787261236763528Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1236265430281265430Rat
2293701Bmd34Bone mineral density QTL 348.30.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)1244401175264636028Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1167394665238830534Rat
2314011Gluco56Glucose level QTL 56blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1217776868220128172Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1189170900234170900Rat
724559Pancm1Pancreatic morphology QTL 17.1islet of Langerhans morphology trait (VT:0005215)pancreatic islet damage composite score (CMO:0001156)1198585664236763415Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1221901238266901238Rat
61341Bp26Blood pressure QTL 26arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1137787261236763528Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1188850303233850303Rat
1582206Kidm33Kidney mass QTL 336.9kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1205603081244401301Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149578693217054291Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1196395041282763074Rat
2292218Kidm35Kidney mass QTL 35kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1217372257244992610Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1161784169219232156Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1221901238266901238Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1235850810280850810Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1215828102260828102Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1189170900234170900Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1226706329271706329Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1222492538267492538Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1196738546241738546Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1225689973270689973Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1194554354239554354Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1189170900234170900Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1230420627262031693Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)182788437239853971Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1130779320219238476Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1213476630278978026Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1161784169278228889Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1217054291281795785Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1255728828282763074Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1221901238266901238Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1213476630278978026Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1213476630278978026Rat
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1233490105264802994Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1189170900234170900Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1215828102260828102Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1189514504234514504Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1244401175282365384Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1215711860258765521Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1156446196274977688Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1233663100273792054Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1215684498260684498Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1244992467282365384Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1189170900234170900Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1215711860260711860Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1236795785281795785Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1221901238266901238Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1189170900234170900Rat
61455Niddm7Non-insulin dependent diabetes mellitus QTL 75.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1236763415258766873Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1189170900234170900Rat
2293700Bmd27Bone mineral density QTL 276.60.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1244401175264636028Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1201358068252480016Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1161784169278228889Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1175447029220447029Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1175447029220447029Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1189170900234170900Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)199983293216213510Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24505 UniSTS
  24506 UniSTS
UniSTS 270424 UniSTS