stSG612955 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: stSG612955

Symbol: stSG612955
Also known as:
RGD ID: 5500769
Expected Size: 0 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.23100,710,273 - 100,711,942 (+)MAPPER
mRatBN7.2356,376,857 - 56,377,572 (+)MAPPER
Rnor_6.0358,185,599 - 58,186,313NCBIRnor6.0
Rnor_6.03105,405,694 - 105,407,362NCBIRnor6.0
Rnor_5.0364,670,960 - 64,671,674UniSTSRnor5.0
Rnor_5.03111,981,063 - 111,982,731UniSTSRnor5.0
RGSC_v3.4399,796,201 - 99,797,869UniSTSRGSC3.4
RGSC_v3.4353,857,720 - 53,858,434UniSTSRGSC3.4
Celera355,924,498 - 55,925,211UniSTS
Celera399,680,496 - 99,682,164UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGTGCATGTGTGTGTGTGTG
Reverse Primer TGCAAGCCTAGGAAGGAAAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3454Ptprjprotein tyrosine phosphatase, receptor type, J37923351979390956Rat
620027Chrm5cholinergic receptor, muscarinic 53103966451104018815Rat
68952Ryr3ryanodine receptor 33104117307104665151Rat
3669Scg5secretogranin V3105235065105279475Rat
619884Hipk3homeodomain interacting protein kinase 339434977894419185Rat
3258Pax6paired box 639570024195728682Rat
68329Pde1aphosphodiesterase 1A36680324767263658Rat
3974Wt1WT1 transcription factor39513322195180574Rat
2311Cd59CD59 molecule39401048194028660Rat
69277Chrna1cholinergic receptor nicotinic alpha 1 subunit36044565760460724Rat
70929Dgkzdiacylglycerol kinase zeta38084400280886487Rat
70937Mapk8ip1mitogen-activated protein kinase 8 interacting protein 138129502381304181Rat
69070Cd82Cd82 molecule38232434482368846Rat
619731Lrp4LDL receptor related protein 438036264380416684Rat
620052Atp5mc3ATP synthase membrane subunit c locus 336081121860813903Rat
2307Cd44CD44 molecule (Indian blood group)39269508392783820Rat
61996F2coagulation factor II38052946880542993Rat
3165Neurod1neuronal differentiation 136641431466417617Rat
69427Pdk1pyruvate dehydrogenase kinase 135853087058561494Rat
2452Cyctcytochrome c, testis36320477963211847Rat
619790Rag1recombination activating 139120639491217491Rat
621862Atf2activating transcription factor 236072113760795951Rat
620887Wipf1WAS/WASL interacting protein family, member 136015000160207125Rat
619922MaddMAP-kinase activating death domain37996030180003023Rat
621330Ambra1autophagy and beclin 1 regulator 138063447080830068Rat
620253P2rx3purinergic receptor P2X 337240399272447801Rat
628615Lgr4leucine-rich repeat-containing G protein-coupled receptor 43101051960101152119Rat
61909Nr1h3nuclear receptor subfamily 1, group H, member 338000413080014197Rat
61914Tfpitissue factor pathway inhibitor37185273871902127Rat
620935Cry2cryptochrome circadian regulator 238131415181344143Rat
2279Catcatalase39337987293412058Rat
620139Chn1chimerin 136051236060668413Rat
628862Rbm45RNA binding motif protein 4536322066063235638Rat
2344Chrm4cholinergic receptor, muscarinic 438083327280841165Rat
621741Timm10translocase of inner mitochondrial membrane 1037222656372230087Rat
621114Ttntitin36356516063837815Rat
621143Ssrp1structure specific recognition protein 137244751672457621Rat
61939Nckap1NCK-associated protein 136772518067804680Rat
727807Hnrnpa3heterogeneous nuclear ribonucleoprotein A336248122262491356Rat
69336Prg2proteoglycan 237238567872389245Rat
2021Acp2acid phosphatase 2, lysosomal38002034680030365Rat
620724Abtb2ankyrin repeat and BTB domain containing 239349470693648750Rat
620360Nfe2l2nuclear factor, erythroid 2-like 236249756862525146Rat
620364Agpsalkylglycerone phosphate synthase36264835262749250Rat
1304877Trim44tripartite motif-containing 4439196878192242138Rat
2952Kcna4potassium voltage-gated channel subfamily A member 439829329598300763Rat
727797Rtn4rl2reticulon 4 receptor-like 237227281472289310Rat
3697Slc1a2solute carrier family 1 member 239251867992665731Rat
735060Mpped2metallophosphoesterase domain containing 239772030897899735Rat
708367Hsd17b12hydroxysteroid (17-beta) dehydrogenase 1238292469983048465Rat
2202Bdnfbrain-derived neurotrophic factor3100768637100819216Rat
621886Rapgef4Rap guanine nucleotide exchange factor 435863233858925127Rat
619756Bbox1gamma-butyrobetaine hydroxylase 13101425684101474848Rat
2630Fshbfollicle stimulating hormone subunit beta39808832198092131Rat
621164Lin7clin-7 homolog C, crumbs cell polarity complex component3101010923101018235Rat
621793Pde11aphosphodiesterase 11A36281850263211843Rat
621877Syt13synaptotagmin 1338181428781852454Rat
61905Psmc3proteasome 26S subunit, ATPase 337987693879882319Rat
735214Large2LARGE xylosyl- and glucuronyltransferase 238127602081285457Rat
735225Serping1serpin family G member 137216123072171109Rat
2255Calcrlcalcitonin receptor like receptor37174793871845487Rat
621633Itga6integrin subunit alpha 635844290458515124Rat
1306473Mtx2metaxin 236175610961818999Rat
1306827Agbl2AGBL carboxypeptidase 237962279179647402Rat
1307457Dusp19dual specificity phosphatase 1936784996667862475Rat
1304695Slc39a13solute carrier family 39 member 1337988452479892664Rat
69073Mdkmidkine38084100380843895Rat
1305588Rag2recombination activating 239119183791200134Rat
1305594Evx2even-skipped homeobox 236156491761581598Rat
1305643Ctnnd1catenin delta 137200190472053047Rat
1305859Elf5E74 like ETS transcription factor 539333351493374454Rat
1305045Emc7ER membrane protein complex subunit 73103945276103955970Rat
1305707Caprin1cell cycle associated protein 139370183093789580Rat
1307327Pacsin3protein kinase C and casein kinase substrate in neurons 338007242580081058Rat
1307960Ube2l6ubiquitin-conjugating enzyme E2L 637219153372206190Rat
1306349Fmn1formin 13104783093105170761Rat
1306707Prkraprotein activator of interferon induced protein kinase EIF2AK236348908163507918Rat
1307982Ola1Obg-like ATPase 135980200759920935Rat
1307721Celf1CUGBP, Elav-like family member 137976890079844548Rat
1306113Fjx1four-jointed box kinase 139228881892290919Rat
1310613Itgavintegrin subunit alpha V37111326971205958Rat
1333562Olr693olfactory receptor 69337810541378106330Rat
1305901Cstf3cleavage stimulation factor subunit 339453058694603378Rat
1306717Nat10N-acetyltransferase 1039365811993698136Rat
1305410Ttc17tetratricopeptide repeat domain 1738319882983306622Rat
1333904Olr771olfactory receptor 7713102859815102860759Rat
1333910Olr453olfactory receptor 45337308926973090213Rat
1333913Olr672olfactory receptor 67237772590477726818Rat
1332770Olr481olfactory receptor 48137348373273484676Rat
1332772Olr790olfactory receptor 7903103399334103400272Rat
1332777Olr563olfactory receptor 56337547797975478923Rat
1333233Olr501-psolfactory receptor pseudogene 50137374294773743886Rat
1333235Olr558olfactory receptor 55837537945175380371Rat
1333237Olr584olfactory receptor 58437587877875879716Rat
1333932Olr544olfactory receptor 54437486763774868575Rat
1333935Olr557olfactory receptor 55737535389275355259Rat
1333944Olr595olfactory receptor 59537599599076000386Rat
1333945Olr585-psolfactory receptor pseudogene 58537590575075905938Rat
1333948Olr552olfactory receptor 55237523450175235439Rat
1333370Olr646olfactory receptor 64637701818677020963Rat
1333400Olr472olfactory receptor 47237335235273353335Rat
1333401Olr498-psolfactory receptor pseudogene 49837369905973699850Rat
1333797Olr458olfactory receptor 45837316163273162570Rat
1333798Olr729olfactory receptor 72937888517078886096Rat
1333823Olr516olfactory receptor 51637401386074014795Rat
1333825Olr554olfactory receptor 55437526552575266475Rat
1333829Olr775olfactory receptor 7753103042803103043741Rat
1333285Olr539olfactory receptor 53937463094574631883Rat
1333286Olr719-psolfactory receptor pseudogene 71937869687578697797Rat
1333291Olr762-psolfactory receptor pseudogene 7623102690348102691284Rat
1333267Olr638-psolfactory receptor pseudogene 63837731689377317801Rat
1333641Olr795olfactory receptor 7953103637469103638407Rat
1333642Olr645-psolfactory receptor pseudogene 64537699935777000277Rat
1333643Olr666olfactory receptor 66637761758377618518Rat
1333645Olr602olfactory receptor 60237610184476102782Rat
1333646Olr617-psolfactory receptor pseudogene 61737641753076421164Rat
1333650Olr664olfactory receptor 66437758499077585925Rat
1332635Olr684olfactory receptor 68437798497077985887Rat
1332636Olr466olfactory receptor 46637327442273275357Rat
1332637Olr541olfactory receptor 54137470077474701712Rat
1333420Olr610olfactory receptor 61037631445876315403Rat
1334151Olr677olfactory receptor 67737788213577883067Rat
1310201Alx4ALX homeobox 438254895982585531Rat
1312016Slc43a3solute carrier family 43, member 337232891272351039Rat
1333498Olr439olfactory receptor 43937276898372769912Rat
1333499Olr779olfactory receptor 7793103127305103128243Rat
1333653Olr517olfactory receptor 51737405288474059247Rat
1333654Olr763olfactory receptor 7633102701378102704404Rat
1333655Olr532olfactory receptor 53237456672074602360Rat
1308395Tp53i11tumor protein p53 inducible protein 1138208183882097064Rat
1308417Hoxd13homeo box D1336159037661593692Rat
1309720Depdc7DEP domain containing 739466571494687013Rat
1332834Olr660olfactory receptor 66037743138977432312Rat
1332842Olr668olfactory receptor 66837766092877661863Rat
1333102Olr471olfactory receptor 47137334444773345385Rat
1333335Olr776olfactory receptor 7763103065454103066392Rat
1333343Olr448olfactory receptor 44837303909373040049Rat
1333346Olr546olfactory receptor 54637518407975185017Rat
1311006C1qtnf4C1q and TNF related 437971358079718018Rat
1333515Olr743-psolfactory receptor pseudogene 74337915121479152139Rat
1333521Olr760olfactory receptor 7603102671356102672294Rat
1333491Olr792olfactory receptor 7923103556674103557624Rat
1333493Olr733olfactory receptor 73337896775178974631Rat
1333867Olr782olfactory receptor 7823103163225103172675Rat
1333063Olr629olfactory receptor 62937669515776696107Rat
1333066Olr513olfactory receptor 51337393327373934208Rat
1333067Olr788olfactory receptor 7883103300450103301388Rat
1333774Olr480olfactory receptor 48037347466773475608Rat
1333136Olr749olfactory receptor 7493102471249102472187Rat
1333140Olr720olfactory receptor 72037871647278717401Rat
1333925Olr764-psolfactory receptor pseudogene 7643102708653102709590Rat
1333928Olr461olfactory receptor 46137320444673205381Rat
1333159Olr438-psolfactory receptor pseudogene 43837276065072761564Rat
1333160Olr565-psolfactory receptor pseudogene 56537550440475505290Rat
1333165Olr578olfactory receptor 57837575156975752501Rat
1333086Olr463olfactory receptor 46337323559473236547Rat
1333087Olr643-psolfactory receptor pseudogene 64337696884876969785Rat
1333089Olr714olfactory receptor 71437836116778362120Rat
1333310Olr601olfactory receptor 60137608501876085971Rat
1333510Olr630olfactory receptor 63037670749276708430Rat
1334162Olr774olfactory receptor 7743102995376103000837Rat
1334169Olr467-psolfactory receptor pseudogene 46737328370673284667Rat
1334170Olr706-psolfactory receptor pseudogene 70637843589578436470Rat
1333143Olr642-psolfactory receptor pseudogene 64237695935376960121Rat
1333144Olr441olfactory receptor 44137280748172808425Rat
1309772Api5apoptosis inhibitor 538331087883336053Rat
1309783Ankrd30aankyrin repeat domain 30A3102293156102430302Rat
1333264Olr561olfactory receptor 56137543783375438804Rat
1332822Olr698olfactory receptor 69837823481378235760Rat
1309690Hoxd4homeo box D436163400561653581Rat
1333172Olr701olfactory receptor 70137827095878271875Rat
1332640Olr631olfactory receptor 63137671776476718684Rat
1332647Olr475olfactory receptor 47537339026873391200Rat
1332674Olr486olfactory receptor 48637356066473561623Rat
1333586Olr571-psolfactory receptor pseudogene 57137560320775604144Rat
1333587Olr553-psolfactory receptor pseudogene 55337525592575256215Rat
1333588Olr780olfactory receptor 7803103140034103140972Rat
1334005Olr738-psolfactory receptor pseudogene 73837906199279062513Rat
1311592Rapsnreceptor-associated protein of the synapse37985981579869486Rat
1332942Olr583olfactory receptor 58337584890475849836Rat
1332947Olr731olfactory receptor 73137894162778942535Rat
621645Aplnrapelin receptor37254053872544183Rat
1309730Iftapintraflagellar transport associated protein39108618691195981Rat
1333951Olr796olfactory receptor 7963103657115103658050Rat
1332686Olr613olfactory receptor 61337634526476346196Rat
1332783Olr736olfactory receptor 73637901755879018487Rat
1333119Olr715olfactory receptor 71537859485578595778Rat
1333154Olr497-psolfactory receptor pseudogene 49737368131273681957Rat
1311292Rcn1reticulocalbin 139540486395419110Rat
1333092Olr586olfactory receptor 58637590694575907880Rat
1333754Olr741olfactory receptor 74137912069479121620Rat
1333756Olr678olfactory receptor 67837789271277893647Rat
1333758Olr590olfactory receptor 59037595759275958524Rat
1333762Olr676-psolfactory receptor pseudogene 67637784691977847850Rat
1333765Olr603-psolfactory receptor pseudogene 60337611473476114902Rat
1333690Olr580-psolfactory receptor pseudogene 58037579533775796249Rat
1332602Olr789olfactory receptor 7893103344395103345333Rat
1332604Olr545olfactory receptor 54537490602474906989Rat
1332611Olr511-psolfactory receptor pseudogene 51137389619473897134Rat
1333624Olr446olfactory receptor 44637300310673004050Rat
1333105Olr709olfactory receptor 70937852507878526022Rat
1333099Olr593-psolfactory receptor pseudogene 59337598014575981046Rat
1334176Olr659olfactory receptor 65937741499977415928Rat
1334046Olr662olfactory receptor 66237749317677494108Rat
1334047Olr768olfactory receptor 7683102801400102802338Rat
1334050Olr536olfactory receptor 53637459646174597393Rat
1332616Olr478-psolfactory receptor pseudogene 47837343787173438829Rat
1332650Olr537olfactory receptor 53737460612174607059Rat
1332655Olr721olfactory receptor 72137872503978725950Rat
1332656Olr692-psolfactory receptor pseudogene 69237809355478094297Rat
1332657Olr531olfactory receptor 53137454429774545241Rat
1332658Olr605-psolfactory receptor pseudogene 60537615465976155592Rat
1333993Olr728olfactory receptor 72837887661278877541Rat
1333999Olr696olfactory receptor 69637819256178193481Rat
1333189Olr712olfactory receptor 71237857076278571715Rat
1334023Olr623olfactory receptor 62337651776576518601Rat
1334025Olr508olfactory receptor 50837383858673839527Rat
1334027Olr592olfactory receptor 59237597059375971528Rat
1333773Olr665olfactory receptor 66537760439277605962Rat
1333703Olr559olfactory receptor 55937539003075390974Rat
1333709Olr460-psolfactory receptor pseudogene 46037318740373188005Rat
1332829Olr493olfactory receptor 49337365264273656116Rat
1332831Olr437-psolfactory receptor pseudogene 43737275167672752336Rat
1333623Olr462olfactory receptor 46237322569573226627Rat
1311463Arl14epADP-ribosylation factor like GTPase 14 effector protein39798150697993684Rat
1333326Olr784olfactory receptor 7843103216590103217528Rat
1333330Olr589-psolfactory receptor pseudogene 58937594309675943567Rat
1333114Olr591-psolfactory receptor pseudogene 59137596870175969314Rat
1332600Olr681olfactory receptor 68137792729377928228Rat
1333526Olr769olfactory receptor 7693102825441102826379Rat
1310767Itprid2ITPR interacting domain containing 236659376766631143Rat
1333222Olr510olfactory receptor 51037387871573879647Rat
1333224Olr566olfactory receptor 56637551828075519224Rat
1333225Olr576olfactory receptor 57637571937375720299Rat
1333916Olr495olfactory receptor 49537366805273668999Rat
1333572Olr538-psolfactory receptor pseudogene 53837462459874625517Rat
1333573Olr626-psolfactory receptor pseudogene 62637665295276653898Rat
1332807Olr770olfactory receptor 7703102841615102842553Rat
1332811Olr679olfactory receptor 67937791062677911561Rat
1312042Lnpklunapark, ER junction formation factor36143212861494828Rat
1333364Olr680-psolfactory receptor pseudogene 68037792170577922556Rat
1333365Olr485olfactory receptor 48537354213873543088Rat
1333275Olr547-psolfactory receptor pseudogene 54737501939475020331Rat
1333604Olr750olfactory receptor 7503102483606102484517Rat
1333606Olr596olfactory receptor 59637603519876036124Rat
1333607Olr732-psolfactory receptor pseudogene 73237896775178967934Rat
1332849Olr658olfactory receptor 65837740165077402579Rat
1332850Olr773olfactory receptor 7733102947730102948668Rat
1332619Olr505olfactory receptor 50537377904173779982Rat
1332626Olr767olfactory receptor 7673102772863102773801Rat
1332627Olr682-psolfactory receptor pseudogene 68237796105777961992Rat
1332749Olr756olfactory receptor 7563102619672102620589Rat
1333349Olr529olfactory receptor 52937450216274503106Rat
1333350Olr694olfactory receptor 69437811184478112770Rat
1333354Olr650olfactory receptor 65037709470977095635Rat
1333355Olr628-psolfactory receptor pseudogene 62837668311876683999Rat
1311652Slc5a12solute carrier family 5 member 123101791336101833044Rat
1560542Prrg4proline rich and Gla domain 439478386694808861Rat
1333410Olr528olfactory receptor 52837447456174475502Rat
1333415Olr651olfactory receptor 65137710990577110831Rat
1333417Olr624olfactory receptor 62437659197576592889Rat
1310905Emc4ER membrane protein complex subunit 43103852139103857172Rat
1332795Olr499olfactory receptor 49937481456874815509Rat
1332798Olr739-psolfactory receptor pseudogene 73937906875579068847Rat
1332799Olr695olfactory receptor 69537832266978323604Rat
1306511Hoxd10homeo box D1036161413361617342Rat
1309797Hoxd12homeo box D1236159738261598503Rat
1309969Prr5lproline rich 5 like39129020791461208Rat
1309463Slc35c1solute carrier family 35 member C138136108081369010Rat
1309928Avenapoptosis and caspase activation inhibitor3103980612104117193Rat
1305239Zfp804azinc finger protein 804A36926834869574118Rat
1333962Olr724olfactory receptor 72437878977178790691Rat
1333978Olr641olfactory receptor 64137692524376926151Rat
1333980Olr753olfactory receptor 7533102553317102554234Rat
1304978Mettl15methyltransferase like 153100186106100366148Rat
1309363Cdca7cell division cycle associated 735915328159163916Rat
1309406Ndufs3NADH:ubiquinone oxidoreductase core subunit S337972168679728863Rat
1308894Ube2e3ubiquitin-conjugating enzyme E2E 336581507665876256Rat
1311315Frzbfrizzled-related protein36763560467668772Rat
1309904Prg3proteoglycan 3, pro eosinophil major basic protein 237239519472401254Rat
1309314Accs1-aminocyclopropane-1-carboxylate synthase38274283082757273Rat
1333220Olr730-psolfactory receptor pseudogene 73037893447878935315Rat
1332801Olr735olfactory receptor 73537900943479010363Rat
1332802Olr647-psolfactory receptor pseudogene 64737703805577038966Rat
1308142Chst1carbohydrate sulfotransferase 138144178581512829Rat
1309540RGD1309540similar to hypothetical protein MGC40841; similar to hypothetical protein MGC470738009258980349249Rat
1308745Pamr1peptidase domain containing associated with muscle regeneration 139240353392502094Rat
1308080Mtch2mitochondrial carrier 237967814179695356Rat
1309179Hoxd1homeo box D136168561961687758Rat
1309107Arhgap11aRho GTPase activating protein 11A3105281827105298108Rat
1311372Pex16peroxisomal biogenesis factor 1638128313781292575Rat
1311373Zswim2zinc finger, SWIM-type containing 237127434171295641Rat
1332859Olr685-psolfactory receptor pseudogene 68537799771177997974Rat
1332860Olr772olfactory receptor 7723102925471102926409Rat
1307679Clp1cleavage factor polyribonucleotide kinase subunit 137212526972137122Rat
1309162Gpr155G protein-coupled receptor 15536005154560105567Rat
1307101Lmo2LIM domain only 239390915693931888Rat
1310234Kbtbd4kelch repeat and BTB domain containing 437972875979735838Rat
1307846Ldlrad3low density lipoprotein receptor class A domain containing 339159673091839054Rat
1310164Ddb2damage specific DNA binding protein 238003043780052984Rat
1309199Cir1corepressor interacting with RBPJ, CIR135999454760023843Rat
1306177Arfgap2ADP-ribosylation factor GTPase activating protein 238008154180093659Rat
1305950Mybpc3myosin binding protein C337994050979958731Rat
1306068Arhgap1Rho GTPase activating protein 138055519680576881Rat
1310685Atg13autophagy related 1338058054980614554Rat
1309238Fnbp4formin binding protein 437957061079610122Rat
1333128Olr447olfactory receptor 44737301078673011730Rat
1333129Olr488olfactory receptor 48837357966873580594Rat
1332692Olr625olfactory receptor 62537662567076626605Rat
1332695Olr530olfactory receptor 53037452369874524663Rat
1332696Olr711olfactory receptor 71137855458678555530Rat
1307706Commd9COMM domain containing 939146361291478097Rat
1307707Ext2exostosin glycosyltransferase 238260278482734557Rat
1305064Scrn3secernin 336002397060048746Rat
1310282Ehfets homologous factor39317625793216484Rat
1332704Olr442olfactory receptor 44237281789672818843Rat
1332707Olr657olfactory receptor 65737738858977389521Rat
1332711Olr746-psolfactory receptor pseudogene 74639945361599454529Rat
1332819Olr464olfactory receptor 46437324971073250663Rat
1332820Olr459olfactory receptor 45937317765673178585Rat
1332821Olr452-psolfactory receptor pseudogene 45237307749873077930Rat
1332864Olr699-psolfactory receptor pseudogene 69937824305778243493Rat
1332866Olr549-psolfactory receptor pseudogene 54937493224774932930Rat
1332868Olr785olfactory receptor 7853103223662103224624Rat
1333603Olr704olfactory receptor 70437840834078409263Rat
1307813Dnajc10DnaJ heat shock protein family (Hsp40) member C1036753828967578308Rat
1305293Fkbp7FKBP prolyl isomerase 736352248063535835Rat
1333430Olr689olfactory receptor 68937804444478045379Rat
1333437Olr518olfactory receptor 51837437043574379077Rat
1333439Olr649olfactory receptor 64937707241077073345Rat
1333830Olr509-psolfactory receptor pseudogene 50937385366273854363Rat
1333831Olr708-psolfactory receptor pseudogene 70837850836778509291Rat
1333833Olr722olfactory receptor 72237874800178748930Rat
1333836Olr542olfactory receptor 54237508812675089064Rat
1308873Ano3anoctamin 33101843516102203368Rat
1308887Osbpl6oxysterol binding protein-like 636325764663455105Rat
1308229Slc43a1solute carrier family 43 member 137223879672265023Rat
1333244Olr600-psolfactory receptor pseudogene 60037607944976080396Rat
1333246Olr526olfactory receptor 52637441166874412633Rat
1333254Olr727olfactory receptor 72737886209478863023Rat
1333259Olr514olfactory receptor 51437394965273950593Rat
1305244Plekha3pleckstrin homology domain containing A336353616663557378Rat
1306853Traf6TNF receptor associated factor 639125282991271607Rat
1560877LOC499843LRRGT0009139072092190751055Rat
1563348Selenohselenoprotein H37207034272071909Rat
1561394Map3k20mitogen-activated protein kinase kinase kinase 2035896502559120507Rat
1334422Olr621olfactory receptor 62137654392176544770Rat
1334334Olr757olfactory receptor 7573102630019102630954Rat
1359731Alkbh3alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase38287424282907467Rat
1334377Olr718olfactory receptor 71837866266378663607Rat
1333782Olr582olfactory receptor 58237582604775835702Rat
1333786Olr787-psolfactory receptor pseudogene 7873103264092103265059Rat
1333019Olr594olfactory receptor 59437598779675988731Rat
1560451Ndufa7lNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7-like35951624359516746Rat
1563711Fibinfin bud initiation factor homolog3101545207101547478Rat
1334339Olr655olfactory receptor 65537719634977197011Rat
1334341Olr707olfactory receptor 70737849314378494067Rat
1334350Olr543-psolfactory receptor pseudogene 54337511596675116283Rat
1564319RGD1564319similar to TF-1 apoptosis related protein 1936567205865673456Rat
1334356Olr587olfactory receptor 58737592286275923797Rat
1560017RGD1560017similar to Ac2-21039483280994833448Rat
1560583Ccdc34coiled-coil domain containing 343101156212101191363Rat
1563263RGD1563263similar to RIKEN cDNA 1700029I1538129427581295027Rat
1561224RGD1561224similar to Ptbp1 protein38955444689555998Rat
1334323Olr742olfactory receptor 74237913275279133669Rat
1334360Olr577olfactory receptor 57737573303275733970Rat
1565658LOC499823LRRG0011437143606571450807Rat
1566059RGD1566059similar to olfactory receptor Olfr12893102679768102684324Rat
1561276RGD1561276similar to olfactory receptor Olfr12893102661393102665287Rat
1332991Olr473olfactory receptor 47337336615573367087Rat
1561057Cerklceramide kinase-like36626883566395615Rat
1311013Lrrc4cleucine rich repeat containing 4C38542116986821783Rat
1560961RGD1560961similar to RIKEN cDNA 0610038L10 gene38974373389745868Rat
1359613Creb3l1cAMP responsive element binding protein 3-like 138089243380933283Rat
1563222RGD1563222similar to RIKEN cDNA A930018P2239403056694037890Rat
1311701Smtnl1smoothelin-like 137220715072219209Rat
1333069Olr581olfactory receptor 58137580944575810383Rat
1333805Olr572-psolfactory receptor pseudogene 57237563824775639183Rat
1333807Olr579-psolfactory receptor pseudogene 57937579330275794227Rat
1333808Olr673olfactory receptor 67337779127877792014Rat
1332720Olr716olfactory receptor 71637862011578621307Rat
1332723Olr675olfactory receptor 67537782557177826506Rat
1332734Olr783olfactory receptor 7833103202361103207304Rat
1332738Olr512-psolfactory receptor pseudogene 51237391242473913313Rat
1332739Olr449-psolfactory receptor pseudogene 44937304561573046317Rat
1334308Olr494-psolfactory receptor pseudogene 49437366306973663789Rat
1334309Olr556olfactory receptor 55637532288475323807Rat
1334311Olr551olfactory receptor 55137504558175045899Rat
1334313Olr450olfactory receptor 45037304831373049251Rat
1334249Olr786olfactory receptor 7863103248396103249331Rat
1334252Olr671olfactory receptor 67137770924577710180Rat
1334112Olr519olfactory receptor 51937434175174342719Rat
1334114Olr524-psolfactory receptor pseudogene 52437431843174319357Rat
1333729Olr564-psolfactory receptor pseudogene 56437549001475490785Rat
1334261Olr644-psolfactory receptor pseudogene 64437697596976977084Rat
1334269Olr479olfactory receptor 47937345563173456572Rat
1334273Olr440olfactory receptor 44037278637872787325Rat
1303069Nup35nucleoporin 3536786678467896828Rat
1333304Olr622-psolfactory receptor pseudogene 62237653197476532850Rat
1333305Olr636olfactory receptor 63637684289876843839Rat
1560142Ypel4yippee-like 437213471972139204Rat
1333454Olr506-psolfactory receptor pseudogene 50637378386473784502Rat
1333455Olr484olfactory receptor 48437352209673523043Rat
1333456Olr648olfactory receptor 64837704746677048401Rat
1333461Olr745olfactory receptor 74537918705579187984Rat
1333471Olr523-psolfactory receptor pseudogene 52337429772974298676Rat
1334032Olr765olfactory receptor 7653102722070102724337Rat
1334035Olr534-psolfactory receptor pseudogene 53437458513874586089Rat
1334011Olr777olfactory receptor 7773103089452103090390Rat
1332745Olr470olfactory receptor 47037333514973336123Rat
1311177Lpcat4lysophosphatidylcholine acyltransferase 43103725762103733888Rat
1332987Olr700-psolfactory receptor pseudogene 70037826293078263882Rat
1333985Olr663olfactory receptor 66337752458377525518Rat
1333986Olr489-psolfactory receptor pseudogene 48937359312773594021Rat
1333988Olr515olfactory receptor 51537398894573989910Rat
1312021Tnks1bp1tankyrase 1 binding protein 137245852072483206Rat
1311181Zfp385bzinc finger protein 385B36426981764556084Rat
1333789Olr540olfactory receptor 54037466945474670392Rat
1333795Olr766olfactory receptor 7663102740880102741818Rat
1359234Zc3h15zinc finger CCCH-type containing 1537102042071040159Rat
1333533Olr573-psolfactory receptor pseudogene 57337565807275658725Rat
1333537Olr469olfactory receptor 46937330790073308823Rat
1333538Olr597olfactory receptor 59737604449576045427Rat
1333540Olr492-psolfactory receptor pseudogene 49237364451273645435Rat
1333542Olr683-psolfactory receptor pseudogene 68337797835977978767Rat
1333472Olr490olfactory receptor 49037362357873624519Rat
1333473Olr604olfactory receptor 60437613451976135475Rat
2359Grem1gremlin 1, DAN family BMP antagonist3105203309105214989Rat
1332993Olr661olfactory receptor 66137748239677483322Rat
1332997Olr713olfactory receptor 71337833984478340788Rat
1311052Nup160nucleoporin 16037949623979562163Rat
1334095Olr627-psolfactory receptor pseudogene 62737666204476662955Rat
1334185Olr667-psolfactory receptor pseudogene 66737765356877654198Rat
1334187Olr496olfactory receptor 49637478988174790822Rat
1334192Olr609olfactory receptor 60937628844076289390Rat
1333046Olr522olfactory receptor 52237425512074256067Rat
1562095Ppp1r1cprotein phosphatase 1, regulatory (inhibitor) subunit 1C36667306066783501Rat
1333883Olr616-psolfactory receptor pseudogene 61637639906176399985Rat
1333887Olr548-psolfactory receptor pseudogene 54837491946174919822Rat
1333594Olr710olfactory receptor 71037854419178545135Rat
1333598Olr444olfactory receptor 44437299035872991302Rat
1334285Olr569olfactory receptor 56937558231775583246Rat
1311335Slc12a6solute carrier family 12, member 63103752213103852686Rat
1334144Olr702olfactory receptor 70237827828578279274Rat
1334434Olr652olfactory receptor 65237712626177127190Rat
1334286Olr717olfactory receptor 71737863931178640261Rat
1334287Olr737olfactory receptor 73737905017779051103Rat
1334084Olr570-psolfactory receptor pseudogene 57037558912575589886Rat
1334085Olr632-psolfactory receptor pseudogene 63237673434176734915Rat
1333859Olr482olfactory receptor 48237349267773493621Rat
1332979Olr614olfactory receptor 61437636795976368909Rat
1334227Olr491olfactory receptor 49137363560473636542Rat
1334115Olr535olfactory receptor 53537458951874590459Rat
1334116Olr654olfactory receptor 65437716915677170085Rat
1334118Olr755-psolfactory receptor pseudogene 7553102588225102588698Rat
1334121Olr562olfactory receptor 56237546539975466355Rat
1334405Olr527olfactory receptor 52737444733274448279Rat
1334408Olr781olfactory receptor 7813103151160103152122Rat
1560612Phf21aPHD finger protein 21A38109976581271841Rat
1334069Olr686olfactory receptor 68637800949878010433Rat
1334071Olr744olfactory receptor 74437916477579165698Rat
1332907Olr436olfactory receptor 43637273959072740519Rat
1332911Olr502olfactory receptor 50237375456973755510Rat
1332919Olr747olfactory receptor 7473102431541102432479Rat
1332922Olr550olfactory receptor 55037499715874998096Rat
1332926Olr476olfactory receptor 47637340010973401074Rat
1311926Med19mediator complex subunit 1937208063072091150Rat
1333685Olr503-psolfactory receptor pseudogene 50337376280873763405Rat
1333686Olr560olfactory receptor 56037541237275413352Rat
1333687Olr611olfactory receptor 61137649532776496283Rat
1334412Olr653olfactory receptor 65337715106177153354Rat
1334414Olr487-psolfactory receptor pseudogene 48737356769073568628Rat
1359607Spi1Spi-1 proto-oncogene37991812779937708Rat
1311224Fads2bfatty acid desaturase 2B37285576772895734Rat
1333049Olr567olfactory receptor 56737557525375576179Rat
1333052Olr633olfactory receptor 63337675160376752514Rat
1333053Olr634olfactory receptor 63437676805176768992Rat
1333545Olr754olfactory receptor 7543102579446102580363Rat
1333550Olr445olfactory receptor 44537299780572998749Rat
1333552Olr456olfactory receptor 45637313822973139143Rat
1333556Olr465olfactory receptor 46537325454673255493Rat
1333558Olr457-psolfactory receptor pseudogene 45737314598373146909Rat
1333480Olr697olfactory receptor 69737821541578216338Rat
1333692Olr454olfactory receptor 45437311505273115987Rat
1333693Olr690olfactory receptor 69037806518878066123Rat
1332935Olr574-psolfactory receptor pseudogene 57437568202875682965Rat
1332937Olr598olfactory receptor 59837605223076053162Rat
1332940Olr443olfactory receptor 44337297427472975218Rat
1332941Olr691olfactory receptor 69137808694378087893Rat
1334379Olr748olfactory receptor 7483102456938102457876Rat
1334383Olr620-psolfactory receptor pseudogene 62037648438276485308Rat
1333038Olr555olfactory receptor 55537529928375300263Rat
1333042Olr674olfactory receptor 67437779920277800137Rat
1332719Olr740-psolfactory receptor pseudogene 74037908971979090636Rat
1334218Olr669olfactory receptor 66937767641477677349Rat
1334372Olr575olfactory receptor 57537571248375713412Rat
1564710Dnajc24DnaJ heat shock protein family (Hsp40) member C2439602538896065765Rat
1334210Olr725olfactory receptor 72537883592978836861Rat
1333007Olr525-psolfactory receptor pseudogene 52537440601274406308Rat
1560121Ttc30a1tetratricopeptide repeat domain 30A136280093262803373Rat
1334426Olr455olfactory receptor 45537312370973124644Rat
1334429Olr619olfactory receptor 61937646829476469265Rat
1332892Olr608olfactory receptor 60837627812476279104Rat
1333660Olr687olfactory receptor 68737801597478016906Rat
1333663Olr507olfactory receptor 50737380053073801471Rat
1333671Olr588olfactory receptor 58837593679575937739Rat
1334294Olr791olfactory receptor 7913103446778103447716Rat
1560411Tspan18tetraspanin 1838209706882236694Rat
1332956Olr637olfactory receptor 63737730922777310156Rat
1333815Olr468olfactory receptor 46837330257173303509Rat
1333817Olr670olfactory receptor 67037769535977696294Rat
1333821Olr778olfactory receptor 7783103109873103111795Rat
1333744Olr752olfactory receptor 7523102529184102530116Rat
1562313Tcp11l1t-complex 11 like 139462143394657467Rat
1334276Olr483olfactory receptor 48337350905673510015Rat
1334278Olr500olfactory receptor 50037373531873762332Rat
1334280Olr635olfactory receptor 63537679018676791115Rat
1334281Olr726olfactory receptor 72637885265478853615Rat
1334282Olr533olfactory receptor 53337457407574575010Rat
1332963Olr612-psolfactory receptor pseudogene 61237634094976341650Rat
1311804Qser1glutamine and serine rich 139470263594767364Rat
1332896Olr794-psolfactory receptor pseudogene 7943103616218103616942Rat
1333746Olr639olfactory receptor 63937689079276891733Rat
1333747Olr705olfactory receptor 70537842866378429583Rat
1333748Olr734olfactory receptor 73437898273078983659Rat
1332951Olr607olfactory receptor 60737624989076250840Rat
1332952Olr640olfactory receptor 64037691771776918646Rat
1332964Olr758olfactory receptor 7583102658573102659511Rat
1332967Olr477olfactory receptor 47737342580173426760Rat
1359456Tmx2thioredoxin-related transmembrane protein 237207342972081079Rat
1333682Olr606olfactory receptor 60637623760776238548Rat
1585049LOC691368similar to olfactory receptor 12783102510339102511282Rat
1585105LOC691309similar to solute carrier family 25, member 53101258551101259748Rat
1586409LOC688691similar to Olfactory receptor 5D1337642272776447415Rat
1584075LOC688891similar to Ras-GTPase-activating protein binding protein 2 (GAP SH3-domain binding protein 2) (G3BP-2)36136894361371098Rat
1565840Eif3meukaryotic translation initiation factor 3, subunit M39499008695007690Rat
1584007Harbi1harbinger transposase derived 138061488680624213Rat
1586443LOC688657similar to Olfactory receptor 5D1337638616776389104Rat
1582771Katnbl1katanin regulatory subunit B1 like 13103511653103513498Rat
1587382LOC296027similar to glyceraldehyde-3-phosphate dehydrogenase3102952298102953280Rat
1583078LOC687629similar to ribosomal protein L3639379667593797002Rat
1559457Sp9Sp9 transcription factor35998195959984489Rat
1582908Hoxd9homeo box D936162019261622360Rat
1583765Sp3Sp3 transcription factor35964457959689011Rat
1562507RGD1562507similar to ribosomal protein S83102602428102603046Rat
1561726Lrrc55leucine rich repeat containing 5537258984072605089Rat
1563596Ckap5cytoskeleton associated protein 538042432080526583Rat
1562221Dcdc5doublecortin domain containing 539720750097435067Rat
1565946Pramel6preferentially expressed antigen in melanoma-like 637555977575563247Rat
1582780Nop10NOP10 ribonucleoprotein3103747654103748739Rat
1566052Elp4elongator acetyltransferase complex subunit 439573381095954987Rat
1562244Sestd1SEC14 and spectrin domain containing 136403781464134973Rat
1561740Kif18akinesin family member 18A3100366168100426867Rat
1566332Pdhxpyruvate dehydrogenase complex, component X39291030092933725Rat
1565990Pramel7preferentially expressed antigen in melanoma-like 737554415575548492Rat
1562526Fam171bfamily with sequence similarity 171, member B37121004871265419Rat
1565066RGD1565066similar to 60S ribosomal protein L3838485952984861084Rat
1564529Nutm1NUT midline carcinoma, family member 13103733981103745242Rat
1565385Cwc22CWC22 spliceosome associated protein homolog36473114564780127Rat
1563448Ccdc73coiled-coil domain containing 7339484877594989984Rat
1561237Tmco5btransmembrane and coiled-coil domains 5B3104721643104765179Rat
1564664RGD1564664similar to LOC387763 protein38285477982856171Rat
1564562ApipAPAF1 interacting protein39296912892998104Rat
1563716RGD1563716similar to hematological and neurological expressed sequence 135958740159588136Rat
1593013Fsip2fibrous sheath-interacting protein 237028518170356568Rat
1589783Ptpmt1protein tyrosine phosphatase, mitochondrial 137973496179743737Rat
1589146LOC684539similar to olfactory receptor Olr49037306409273065033Rat
1588523LOC364803similar to sorbitol dehydrogenase 13105178597105182322Rat
1592094LOC295681similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)36480108764809553Rat
1592950LOC680379similar to 60S ribosomal protein L3237084298870843677Rat
1592203LOC690761similar to Fructose-bisphosphate aldolase A (Muscle-type aldolase)38999974190037760Rat
1590781LOC499841similar to heat shock protein 1, beta38801658888018805Rat
1590784Ttc30btetratricopeptide repeat domain 30B36275875462761325Rat
1592093LOC295698similar to heat shock protein 837067900670680453Rat
1590225LOC685743hypothetical protein LOC68574337540001175404569Rat
1589686LOC366097hypothetical LOC36609737236762272369371Rat
1589690LOC366085hypothetical pseudogene on chromosome 3q2436499681864998799Rat
1585192LOC690017similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)37975661979761210Rat
1589864Muc15mucin 15, cell surface associated3101895363101912979Rat
1589737Zdhhc5zinc finger DHHC-type palmitoyltransferase 537209052672118406Rat
1587670Eno1-ps1enolase 1, (alpha), pseudogene 135940853159410209Rat
1587891LOC684683similar to olfactory receptor Olr47037332775373328841Rat
1588374LOC502637similar to prothymosin alpha36155468261555122Rat
1586299LOC691202similar to Histidine triad nucleotide-binding protein 1 (Adenosine 5-monophosphoramidase) (Protein kinase C inhibitor 1) (Protein kinase C-interacting protein 1) (PKCI-1) (17 kDa inhibitor of protein kinase C)39795422897954741Rat
1590646LOC680514similar to ras homolog gene family, member G37165199871652561Rat
1587010LOC680873similar to Wolf-Hirschhorn syndrome candidate 237284294172846160Rat
1590614LOC680546similar to 40S ribosomal protein S7 (S8)37183718071837906Rat
1586246LOC691265similar to 40S ribosomal protein S63100115924100116832Rat
1584801LOC679740hypothetical protein LOC67974036498439264989706Rat
1587441Immp1linner mitochondrial membrane peptidase subunit 139595512696024316Rat
1586250LOC691260hypothetical protein LOC6912603100040180100041085Rat
1588500LOC366150similar to Adenosylhomocysteinase (S-adenosyl-L-homocysteine hydrolase) (AdoHcyase) (Liver copper-binding protein) (CUBP)3100608849100610109Rat
1588501LOC366145similar to ribosomal protein L639530666495308150Rat
1588503LOC366141similar to ribosomal protein S839278948892794356Rat
1588504LOC366131hypothetical LOC36613138805893388059435Rat
1588505LOC366130similar to Down syndrome critical region protein 3 homolog (Down syndrome critical region protein A homolog)38580716285847237Rat
1593433Fbxo3F-box protein 339396882794000863Rat
1596954LOC678730similar to Acidic leucine-rich nuclear phosphoprotein 32 family member A (Leucine-rich acidic nuclear protein)36320649963207432Rat
1592240LOC690724similar to heat shock protein 1, beta38914591489148089Rat
1592252LOC690712similar to adaptin-ear-binding coat-associated protein 138867935488680518Rat
1594965LOC686683similar to olfactory receptor 7337618610476187045Rat
1594971LOC686677similar to olfactory receptor 116137617921476180146Rat
1595007LOC686641similar to olfactory receptor 116037605914876062448Rat
1587131Pjvkpejvakin36350838663518163Rat
1594833LOC689219similar to serine (or cysteine) proteinase inhibitor, clade B, member 1a37769707477697745Rat
1596039Accsl1-aminocyclopropane-1-carboxylate synthase-like38276286182777814Rat
1593249Itga4integrin subunit alpha 436617874566265547Rat
1593250Ccdc141coiled-coil domain containing 14136386524064024208Rat
1590196LOC685772similar to suppression of tumorigenicity 1337541416975415741Rat
1588601Hoxd3homeo box D336165056961670285Rat
1588370LOC502660similar to olfactory receptor 13183103597161103598156Rat
1588371LOC502653similar to myc induced nuclear antigen38205385682055199Rat
1588372LOC502650similar to Double-strand-break repair protein rad21 homolog (Pokeweed agglutinin-binding protein 29) (PW29) (SCC1 homolog)37591503075916859Rat
1588621LOC691083hypothetical protein LOC69108339531280995398594Rat
1597330Prdm11PR/SET domain 1138186273781942203Rat
1591313LOC686900similar to olfactory receptor 119837736495577365887Rat
1590104LOC687065similar to olfactory receptor Olr69537813401878135046Rat
1594334Bex4-ps1brain expressed X-linked 4, pseudogene 137759801077598707Rat
2318583Znf408zinc finger protein 40838054910280555186Rat
2319335LOC100361842hypothetical LOC10036184238752002687520490Rat
2318156LOC100362432mitochondrial import inner membrane translocase subunit Tim23-like38297078582971887Rat
2318157Ttc30atetratricopeptide repeat domain 30A36280363562810291Rat
2318201LOC100365887rCG27063-like37619879076213128Rat
2320108LOC100361457actin, gamma 1 propeptide-like37564305375644978Rat
2319534LOC100361740ribosomal RNA processing 8, methyltransferase, homolog38579138185792801Rat
2320278LOC100361387hypothetical LOC10036138737965379179665884Rat
2320625LOC100364636hypothetical LOC10036463636150651261546375Rat
2320728LOC100361132mitochondrial ribosomal protein S3635837867258379247Rat
2322993LOC100363452ribosomal protein S8-like3103192670103193343Rat
2323045LOC100363400hypothetical LOC1003634003103100299103106275Rat
2321748Olfr1055olfactory receptor 105537475797574758853Rat
2322673LOC100360176transcription factor Dp 137565758875659343Rat
2323302LOC100359840hypothetical LOC10035984035934767959352373Rat
2323331LOC100359810hypothetical LOC10035981037427951474281950Rat
2323370Btbd18BTB domain containing 1837206081172070566Rat
2323539LOC100359701rCG44996-like37378434573790328Rat
2323648Hmgn4high mobility group nucleosomal binding domain 43104675173104675525Rat
2324332LOC100362626HIG1 domain family, member 1A38661358186614008Rat
2323669LOC100359525PRELI domain containing 1-like3103701112103705222Rat
2323737LOC100362956hypothetical LOC10036295636892326468923837Rat
2323858LOC100359435cleavage stimulation factor, 3 pre-RNA, subunit 3 (predicted)-like3103690957103691421Rat
2325385Mir130amicroRNA 130a37214103772141124Rat
2325397Mir10bmicroRNA 10b36164797861648086Rat
2323964LOC100362814hypothetical protein LOC10036281439405854694334805Rat
2325612Mir129-2microRNA 129-238313729783137393Rat
2324116LOC100362742heterogeneous nuclear ribonucleoprotein H139937478099376065Rat
4888574Mir3590microRNA 359037214104472141117Rat
6489440Hoxd8homeobox D836162732961629743Rat
6492495LOC100911542E3 SUMO-protein ligase PIAS2-like37906887479070053Rat
6486084LOC100912623glyceraldehyde-3-phosphate dehydrogenase-like37148667171487568Rat
6487186LOC100912353uncharacterized LOC10091235339500772695008790Rat
6487743LOC10091232260S ribosomal protein L19-like3101920682101921507Rat
6495960LOC100910935alpha-enolase-like37094267570944022Rat
6496053LOC100910817olfactory receptor 4C6-like37726900977269908Rat
6502878LOC100909651olfactory receptor 5D13-like37649532776498822Rat
6499738LOC100910165olfactory receptor 1052-like37499023074991168Rat
6500051LOC100910096ribosome biogenesis protein NSA2 homolog36419086064191853Rat
6503504LOC100909421ADP/ATP translocase 2-like37151273771513684Rat
6497629LOC100910590serine/arginine-rich splicing factor 3-like39966778399750990Rat
6500739Olr1258olfactory receptor 125837877252578773444Rat
6500810LOC100910012ATP synthase lipid-binding protein, mitochondrial-like38283998282843019Rat
6501637Dcdc1doublecortin domain containing 139611142096126420Rat
7525020LOC102552075uncharacterized LOC10255207539391631393919991Rat
7527047LOC102552809uncharacterized LOC10255280936112474261125535Rat
7504271LOC102548073uncharacterized LOC10254807339104937791054378Rat
7504310LOC102553348high mobility group protein B1-like36069801460699109Rat
7530199LOC102555995uncharacterized LOC10255599537990988779910846Rat
7531281LOC102551977uncharacterized LOC10255197739389725993900921Rat
7516550LOC102550998sperm motility kinase 3-like39214490292147340Rat
7539503LOC102548640ribosome biogenesis protein NSA2 homolog39199228191996313Rat
7539539LOC102549766uncharacterized LOC10254976638414755784162218Rat
7521145LOC102546631tubulin-specific chaperone A-like35983834659840504Rat
7645726LOC102553121uncharacterized LOC10255312136647285266478730Rat
7631560LOC102553315ribosome biogenesis protein WDR12-like3104757466104763761Rat
7632234LOC102549184uncharacterized LOC10254918439374869193757982Rat
7662975LOC102557176ATP synthase F(0) complex subunit C1, mitochondrial-like38086314180867161Rat
7632749LOC102555068igE-binding protein-like36843845768440294Rat
7637641LOC102549894uncharacterized LOC10254989438145162081496761Rat
7624532LOC102553063uncharacterized LOC10255306336137154761374579Rat
7625660LOC102546895uncharacterized LOC10254689538170330181727396Rat
7587466LOC102550195glyceraldehyde-3-phosphate dehydrogenase-like3100684160100685060Rat
7657591LOC102552076uncharacterized LOC1025520763104773077104779764Rat
7642688LOC102554972uncharacterized LOC10255497237257796772579765Rat
7612019LOC102546819uncharacterized LOC10254681935977583059827941Rat
7568515LOC102551792twinfilin-2-like3105163496105166609Rat
7593039LOC102554396uncharacterized LOC10255439637227391972275356Rat
7593443LOC102553064uncharacterized LOC10255306439519148895193094Rat
7596485LOC102546445uncharacterized LOC10254644538028460280285371Rat
7598318LOC102548277uncharacterized LOC10254827737108465671105173Rat
7545237LOC102551620uncharacterized LOC10255162038803052388032335Rat
7545246LOC102551299uncharacterized LOC10255129936281007662817724Rat
7560679LOC10255585060S ribosomal protein L10-like36252750462530714Rat
7578806LOC102551301proteasome subunit beta type-3-like3104069379104070232Rat
7579074LOC102555599olfactory receptor 5L1-like37611396476114902Rat
7562021LOC102548825uncharacterized LOC10254882539309633993107941Rat
7580981LOC102551066coiled-coil domain-containing protein 34-like3101186029101190869Rat
7549589LOC102555148uncharacterized LOC10255514835826865558275095Rat
7584006LOC102551100uncharacterized LOC10255110039209476092141001Rat
7566091LOC102554564uncharacterized LOC10255456436244447462446763Rat
7584653LOC102549214uncharacterized LOC10254921435825310358267395Rat
7606520LOC102552170uncharacterized LOC10255217036047513860504203Rat
7554189LOC102553122uncharacterized LOC10255312239563794695639665Rat
7554897LOC10255355240S ribosomal protein S7-like36142488861430341Rat
7735004LOC102553948uncharacterized LOC10255394836189445061910573Rat
7692507LOC102547721uncharacterized LOC10254772136770878167714441Rat
7692756LOC102553021uncharacterized LOC10255302136640318466437012Rat
7694271LOC102555600uncharacterized LOC10255560037947368679496750Rat
7695074LOC102550423uncharacterized LOC10255042338440634084420054Rat
7752709LOC102556671uncharacterized LOC10255667135938855859404628Rat
7704830LOC10254785015 kDa interferon-responsive protein-like36837369068374109Rat
7676797LOC102555454uncharacterized LOC10255545437939111079392152Rat
7704882LOC102555817dynein heavy chain 17, axonemal-like35952233959529760Rat
7705590LOC102552328uncharacterized LOC10255232836052059460522523Rat
7684934LOC10255119760S ribosomal protein L19-like3103879447103880767Rat
7708664LOC102548485uncharacterized LOC10254848537122172171224846Rat
7724987LOC102552587uncharacterized LOC10255258736592131766017347Rat
7712266LOC102552985uncharacterized LOC10255298539510045395102752Rat
7731473LOC102549083growth factor receptor-bound protein 7-like3100251794100275704Rat
7731804LOC102555296uncharacterized LOC10255529635904089259042440Rat
7733574LOC102554395uncharacterized LOC10255439536230074362303280Rat
7738850LOC102546693uncharacterized LOC10254669338133437881342404Rat
7743163LOC102548892uncharacterized LOC10254889239335173393359893Rat
7718479LOC102553814serine/arginine repetitive matrix protein 1-like36455600464650323Rat
7670649LOC10254932440S ribosomal protein S2-like38270220182704465Rat
7744015LOC10254748960S ribosomal protein L27a-like38764598487646418Rat
7674410LOC102547078myb-related transcription factor, partner of profilin-like38188308881887408Rat
7710286LOC102550482high mobility group protein B1-like3101432194101439067Rat
7711558LOC102554010uncharacterized LOC10255401036197526961980258Rat
7729778LOC102552685uncharacterized LOC10255268536606581466077085Rat
7730597Hoxd11homeobox D1136160425661606874Rat
9087182LOC103691855uncharacterized LOC10369185539856164598570307Rat
9129688LOC103691834spidroin-2-like36413429564163622Rat
9092875LOC10369181960S ribosomal protein L9 pseudogene35960400659605799Rat
9176020LOC103691841uncharacterized LOC10369184137023562570241327Rat
9177312LOC103691837uncharacterized LOC10369183736771928867724926Rat
9078858LOC103695171uncharacterized LOC10369517135886657358890606Rat
9183373LOC103691820uncharacterized LOC10369182035973828859749268Rat
9183958LOC103691827uncharacterized LOC10369182736428090164282793Rat
9186608LOC103691828uncharacterized LOC10369182836457763364583106Rat
9106594LOC103691857prohibitin-2 pseudogene3102044783102046120Rat
9187945LOC103691838uncharacterized LOC10369183837185605871859175Rat
9112676LOC103690075olfactory receptor 4P4-like37728970777290838Rat
9165094LOC103691852gamma-aminobutyric acid receptor-associated protein-like 2 pseudogene39510508295106768Rat
9120807LOC103691873putative olfactory receptor GPCRLTM73103464128103464778Rat
9204116LOC103691859uncharacterized LOC1036918593104214577104215328Rat
9124575LOC103691830uncharacterized LOC10369183036659189966593641Rat
9125033LOC103691835uncharacterized LOC10369183536723931467263652Rat
9209512LOC103691847uncharacterized LOC10369184738088023180953000Rat
9214897LOC103691854uncharacterized LOC10369185439795492297973607Rat
9221591LOC103691824uncharacterized LOC10369182436167328061676585Rat
9353915LOC103691840DNA polymerase epsilon subunit 4 pseudogene36963699469637422Rat
9224218LOC103691818uncharacterized LOC10369181835954434859546824Rat
9354787LOC103691849uncharacterized LOC10369184939096363190975175Rat
9231074LOC103691825uncharacterized LOC10369182536259370662599492Rat
9277103LOC103691860uncharacterized LOC1036918603105325905105351664Rat
9281514LOC103691850uncharacterized LOC10369185039123051991241050Rat
9373253LOC103691848uncharacterized LOC10369184838096436280970468Rat
9374791LOC103691832titin-like36377566063783202Rat
9287218LOC103690355olfactory receptor 4C11-like37686232276863285Rat
9328340LOC103691858uncharacterized LOC1036918583104008341104009946Rat
9290598LOC103691829uncharacterized LOC10369182936603497266042705Rat
9254480LOC103691836uncharacterized LOC10369183636741429267464278Rat
9261493LOC103691844uncharacterized LOC10369184437947888179479693Rat
9345818LOC103691823NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1 pseudogene36087358960873919Rat
9363764LOC103691817uncharacterized LOC10369181735941246759435352Rat
9422868LOC103695172uncharacterized LOC10369517235981793359839929Rat
9463888LOC103691846uncharacterized LOC10369184638053252080533885Rat
9463895LOC103691853uncharacterized LOC10369185339771806597722134Rat
9330172LOC10369182160S ribosomal protein L27 pseudogene35991575659916448Rat
9388772LOC103691856uncharacterized LOC10369185639952808899538169Rat
9390404LOC103691839olfactory receptor 5M3-like37338367373384578Rat
9396391LOC103690330uncharacterized LOC1036903303102293156102377025Rat
9400923LOC103691816uncharacterized LOC10369181635830124258306076Rat
9405036LOC103691851uncharacterized LOC10369185139245341092455003Rat
9450923LOC103691826CAVP-target protein-like36378661363787869Rat
11361272LOC108350586uncharacterized LOC1083505863104062683104068579Rat
11369516LOC10835039560S ribosomal protein L7a pseudogene35916535359166153Rat
11455941LOC10835056240S ribosomal protein S26-like37962050979620862Rat
11448890LOC10835060640S ribosomal protein S28 pseudogene3103037068103037318Rat
11461810LOC10835043160S ribosomal protein L19 pseudogene39666874696669311Rat
11463544LOC108350420uncharacterized LOC10835042039104145991051805Rat
11466658LOC108350400uncharacterized LOC10835040036212621362137120Rat
11469551Fam180bfamily with sequence similarity 180 member B37971811679721044Rat
11469669LOC108350437uncharacterized LOC1083504373105299345105304909Rat
11435666LOC108350403uncharacterized LOC10835040336228352162286116Rat
11444049LOC108350402uncharacterized LOC10835040236219006762202455Rat
11362073LOC108350398uncharacterized LOC10835039836043748560439887Rat
11435886LOC10835039960S ribosomal protein L19 pseudogene36072254860726276Rat
11436885LOC108350585uncharacterized LOC1083505853104375296104383320Rat
11445349LOC108350417uncharacterized LOC10835041738140357181433615Rat
11437224LOC108350397uncharacterized LOC10835039735955350559619664Rat
11368395LOC10835060560S ribosomal protein L39-like3102866534102866689Rat
11446776LOC10835059540S ribosomal protein S13-like35921977559220936Rat
11357604LOC108350432uncharacterized LOC10835043239766041297678903Rat
11360265LOC108350409uncharacterized LOC10835040936654745766569904Rat
11448031LOC108350426uncharacterized LOC10835042639396550193968836Rat
11362616LOC10835060260S ribosomal protein L7a pseudogene38503725485038087Rat
11429002LOC10835043660S ribosomal protein L17 pseudogene3105302734105303843Rat
11430655LOC10835042760S ribosomal protein L35a pseudogene39593924595939649Rat
11440902LOC108350604ankyrin repeat and BTB/POZ domain-containing protein 2-like39365230593653154Rat
11440940LOC108350416uncharacterized LOC10835041638131202081314991Rat
11384017LOC10835042440S ribosomal protein S10 pseudogene39344708893449469Rat
11406701LOC108350407protein argonaute 2-like36581300565815426Rat
11414657LOC108350559alpha-enolase pseudogene37549253675493378Rat
11417539LOC108350406uncharacterized LOC10835040636534363965346940Rat
11418915LOC108350600H/ACA ribonucleoprotein complex subunit 3 pseudogene37098176870981978Rat
11419102LOC108350423uncharacterized LOC10835042339341845393422813Rat
11422631LOC108350582serine/arginine-rich splicing factor 3 pseudogene36002069560023765Rat
11423265LOC108350433uncharacterized LOC10835043339803372198045500Rat
11427426LOC10835043460S ribosomal protein L7a pseudogene39869552798696323Rat
11373693LOC108350418uncharacterized LOC10835041838175323681755676Rat
11409438LOC108350561copine-8 pseudogene37795610877956907Rat
11387834LOC10835060360S ribosomal protein L7a pseudogene38956013789560942Rat
11400775LOC108350429uncharacterized LOC10835042939601416296023060Rat
11378386LOC10835058460S ribosomal protein L30-like3104089996104091538Rat
11389938LOC108350435growth factor receptor-bound protein 7 pseudogene3100267304100277861Rat
11380115LOC108350394uncharacterized LOC10835039435837925558406210Rat
11380967LOC108350412uncharacterized LOC10835041237194736171953655Rat
11382298LOC10835054460S ribosomal protein L7a pseudogene39340865993411838Rat
11392957LOC108350422uncharacterized LOC10835042239224097292247658Rat
11393210LOC108350408uncharacterized LOC10835040836641819466443018Rat
11404757LOC108350414uncharacterized LOC10835041437943881279445124Rat
11476302LOC10835041140S ribosomal protein S7 pseudogene37183394971838615Rat
11477246LOC108350415low molecular weight phosphotyrosine protein phosphatase pseudogene38049151280493747Rat
11478124Trnap-agg5transfer RNA proline (anticodon AGG) 537130601871306091Rat
11478808LOC108350396uncharacterized LOC10835039635928271859288237Rat
11503995LOC108350419uncharacterized LOC10835041938337466783414094Rat
11504008LOC108350601uncharacterized LOC10835060137498035574994393Rat
11496486LOC10835041060S ribosomal protein L7a pseudogene37126551271268162Rat
11496778LOC108350413uncharacterized LOC10835041337226750972269262Rat
11496882LOC108350558endogenous retrovirus group K member 11 Pol protein-like36843592368437926Rat
11497441LOC108350598high mobility group protein B1 pseudogene36538336265384083Rat
11509734LOC108350599DNA polymerase epsilon subunit 4 pseudogene36963638669637407Rat
11498064LOC108350596NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7 pseudogene35951622459517656Rat
11498171LOC108350401uncharacterized LOC10835040136217426862202343Rat
11498180LOC108350405uncharacterized LOC10835040536416815064182635Rat
11514172LOC108350557uncharacterized LOC10835055735912237059140151Rat
11514823LOC10835043060S ribosomal protein L19 pseudogene39667601496676579Rat
11484255LOC108350428uncharacterized LOC10835042839606583096132988Rat
11516244LOC108350421uncharacterized LOC10835042139171447691724250Rat
11486579LOC108350597ubiquitin-conjugating enzyme E2 S-like36069773560699697Rat
11492074LOC108350404uncharacterized LOC10835040436414861964154370Rat

Nucleotide Sequences
GenBank Nucleotide AC109739 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31802366463023664Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
631685Bp118Blood pressure QTL 1183.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)32465522569655225Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32932171474321714Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32968273274682732Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32968273274682732Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32968273274682732Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32968273274682732Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32968273274682732Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32990825574908255Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32990825574908255Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)330114912123700444Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)330846101172879276Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33110358972989078Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33110358972989078Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33110358972989078Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33110358972989078Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33110358972989078Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33110358972989078Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33213099777130997Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33213099777130997Rat
1300169Bp177Blood pressure QTL 1772.96arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)33347735462922975Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33347735481136227Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333477354108914061Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)334394121103141944Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)339248391140271184Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)34042292185422921Rat
2302276Bw82Body weight QTL 824.32body mass (VT:0001259)body weight (CMO:0000012)34052359364880586Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)34052359392654473Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)34052359392654473Rat
1354597Kidm13Kidney mass QTL 132.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)343295930108914061Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)343295930163640485Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)343295930163640485Rat
1300178Hrtrt4Heart rate QTL 43.74heart pumping trait (VT:2000009)heart rate (CMO:0000002)34540605894467785Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)345406058127023997Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)345406058177699992Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)348561928155263151Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)351821836124513579Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)351822008120917851Rat
1582249Bw77Body weight QTL 773.20.0025epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)35463094866711785Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)354630948119830094Rat
61377Edpm3Estrogen-dependent pituitary mass QTL 37.050.038pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)35463104693415673Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)35524527695176874Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)35524527695176874Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)35524527695176874Rat
1358293Bw38Body weight QTL 3860.0000031body mass (VT:0001259)body weight (CMO:0000012)356735995101735995Rat
1581568Rf53Renal function QTL 53total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)358204463170534769Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)361241033165369047Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)362922868127023997Rat
631200Cm25Cardiac mass QTL 254.80.0001heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)36304905092654302Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)366711607119830094Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)366711607119830094Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)372672290127023997Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)372973445127023997Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)378700444123700444Rat
1581546Pur13Proteinuria QTL 132.930.0335total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)381136227154416635Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)383817637119509260Rat
7387306Bw124Body weight QTL 1243.20.0003body mass (VT:0001259)body weight (CMO:0000012)388910015133910015Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)394788365139788365Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)397009185142009185Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)399465522168732722Rat
1582252Sual1Serum uric acid level QTL 13.40.0123blood uric acid amount (VT:0010302)blood uric acid level (CMO:0000501)3100730984106900596Rat
1582219Bw63Body weight QTL 633.80.001body mass (VT:0001259)body weight (CMO:0000012)3100730984119830094Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)3101058963146058963Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)3102152812155263151Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)3102466149147466149Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)3103141814176418101Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)3103141814176418101Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3103141814176418101Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)3103141944170934860Rat


Additional Information

Database Acc Id Source(s)
UniSTS 451094 UniSTS