UniSTS:234430 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:234430

Symbol: UniSTS:234430
Also known as:
RGD ID: 5499737
Expected Size: 201 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2359,651,203 - 59,651,404 (+)MAPPER
Rnor_6.0361,671,204 - 61,671,404NCBIRnor6.0
Rnor_5.0368,136,741 - 68,136,941UniSTSRnor5.0
RGSC_v3.4357,363,420 - 57,363,620UniSTSRGSC3.4
Celera359,172,616 - 59,172,816UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGCTCACTAATGATGGCTCA
Reverse Primer GCGTGGGTAAAATATGCCTT
 

Region

Nucleotide Sequences


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31802366463023664Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
631685Bp118Blood pressure QTL 1183.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)32465522569655225Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32932171474321714Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32968273274682732Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32968273274682732Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32968273274682732Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32968273274682732Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32968273274682732Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32990825574908255Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32990825574908255Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)330114912123700444Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)330846101172879276Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33110358972989078Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33110358972989078Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33110358972989078Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33110358972989078Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33110358972989078Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33110358972989078Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33213099777130997Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33213099777130997Rat
1300169Bp177Blood pressure QTL 1772.96arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)33347735462922975Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33347735481136227Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333477354108914061Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)334394121103141944Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)339248391140271184Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)34042292185422921Rat
2302276Bw82Body weight QTL 824.32body mass (VT:0001259)body weight (CMO:0000012)34052359364880586Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)34052359392654473Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)34052359392654473Rat
1354597Kidm13Kidney mass QTL 132.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)343295930108914061Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)343295930163640485Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)343295930163640485Rat
1300178Hrtrt4Heart rate QTL 43.74heart pumping trait (VT:2000009)heart rate (CMO:0000002)34540605894467785Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)345406058127023997Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)345406058177699992Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)348561928155263151Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)351821836124513579Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)351822008120917851Rat
1582249Bw77Body weight QTL 773.20.0025epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)35463094866711785Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)354630948119830094Rat
61377Edpm3Estrogen-dependent pituitary mass QTL 37.050.038pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)35463104693415673Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)35524527695176874Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)35524527695176874Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)35524527695176874Rat
1358293Bw38Body weight QTL 3860.0000031body mass (VT:0001259)body weight (CMO:0000012)356735995101735995Rat
1581568Rf53Renal function QTL 53total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)358204463170534769Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)361241033165369047Rat


Additional Information

Database Acc Id Source(s)
UniSTS 234430 UniSTS