MARC_4117-4118:991938388:1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner
Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: MARC_4117-4118:991938388:1

Symbol: MARC_4117-4118:991938388:1
Also known as:
RGD ID: 5499627
Expected Size: 111 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01620,294,454 - 20,294,655NCBIRnor6.0
Rnor_6.0651,246,027 - 51,246,137NCBIRnor6.0
Rnor_5.01620,151,998 - 20,152,199UniSTSRnor5.0
Rnor_5.0659,916,676 - 59,916,786UniSTSRnor5.0
RGSC_v3.41619,043,240 - 19,043,441UniSTSRGSC3.4
RGSC_v3.4650,215,830 - 50,215,940UniSTSRGSC3.4
Celera1618,736,389 - 18,736,590UniSTS
Celera647,746,028 - 47,746,138UniSTS
Cytogenetic Map16p14UniSTS
Cytogenetic Map6q16UniSTS
Is Marker For: Genes:   Hbp1   Rpl18a   LOC100911623  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCCGCTTCTGGTACTTTGT
Reverse Primer GAAGTTCTTCACTCGCAGGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620444Hbp1HMG-box transcription factor 165123147951257699Rat
7663848LOC10255564560S ribosomal protein L18a-like65124572551246824Rat
1302976Rpl18aribosomal protein L18A162029327720295283Rat

Nucleotide Sequences
RefSeq Transcripts NM_212510 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB005653 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC058498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ209874 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ209881 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ209956 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ210713 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ216877 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221165 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221243 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221413 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221458 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221831 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222162 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222289 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222457 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222474 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222662 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223818 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ226007 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228440 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G72773 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6175623393Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)6112039375023446Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)62537030111715717Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)6616172276002731Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)6616172276002731Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)67009971115379601Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)71017386255173862Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)61312295857516539Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
8552910Pigfal5Plasma insulin-like growth factor 1 level QTL 54.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)61941788764417887Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62151530265784818Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62204285484763421Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62204285484763421Rat
8693632Alc27Alcohol consumption QTL 272.20.791drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)63425776653855198Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63436743680490628Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63499565675623393Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63626028860606186Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63626028884763275Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63760898075023446Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63810630883106308Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63819641260606431Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)64167904686679046Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)64167904686679046Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)64167904686679046Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)648432758108268790Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16501380245905331Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16501380245905331Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16501380245905331Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161939818770590230Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161939818770590230Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161939818770590230Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161939818770590230Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16141240937Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16127556253Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16501380250169318Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16501380264012784Rat
631561Hcuc2Hepatic copper content QTL 22.8hepatic copper amount (VT:0003065)liver total copper weight (CMO:0001507)16141240957Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16141240937Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16127556253Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16134465490Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)16155018763210301Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16155018763210301Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)16155018763210301Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)16155018763210301Rat
631517Scl9Serum cholesterol level QTL 93.3blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)161730939622744540Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16133160624Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16127556253Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16124228366Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)16109005486162972Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16413635523105837Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16172829746728297Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16413635545905331Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)16155018749247447Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16501380250013802Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16501380252144919Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)1624459345244593Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16131816439Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16134074146340741Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100911623 UniSTS
  27080 UniSTS
  290641 UniSTS
UniGene Rn.105821 UniSTS
  Rn.129447 UniSTS
  Rn.91296 UniSTS
UniSTS 231073 UniSTS