AU028637 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AU028637

Symbol: AU028637
Also known as:
RGD ID: 5499192
Expected Size: 0 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38565,922,468 - 65,923,368UniSTSGRCm38
GRCm389107,845,797 - 107,847,148UniSTSGRCm38
MGSCv379107,748,128 - 107,749,479UniSTSGRCm37
MGSCv37566,313,707 - 66,314,607UniSTSGRCm37
Celera9107,454,132 - 107,455,483UniSTS
Celera563,219,004 - 63,219,904UniSTS
Cytogenetic Map9F1-F2UniSTS
Is Marker For: Genes:   Rbm6  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCCTGTTGGTGCTGCAA
Reverse Primer CTCTTCTGGTGTGTCTGAAGACAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1558558Rbm6RNA binding motif protein 69107773559107873358Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1301693Sle6_msystemic lupus erythematosus susceptibility 6 (mouse)Not determined5884069387693978Mouse
11341716Rvfs3_mRift Valley fever susceptibility 3 (mouse)526236236138457140Mouse
4140990Lgq6_mlate growth QTL 6 (mouse)Not determined31975890100630065Mouse
4141219W10q16_mweight 10 weeks QTL 16 (mouse)Not determined31975890100630065Mouse
10043995Hbnr9_mHeligmosomoides bakeri nematode resistance 9 (mouse)Not determined53333132567331534Mouse
1301845Lxw4_mlupus BXSB x NZW 4 (mouse)Not determined53553712069537252Mouse
11049558Lmr24b_mleishmaniasis resistance 24b (mouse)53553712069537252Mouse
11049559Lmr24c_mleishmaniasis resistance 24c (mouse)53553712069537252Mouse
11049561Lmr24e_mleishmaniasis resistance 24e (mouse)53553712069537252Mouse
1301223Hdlq7_mHDL QTL 7 (mouse)Not determined53569722669697372Mouse
13464252Ahl10_mage related hearing loss, early onset 10 (mouse)53569722669697372Mouse
4141647Hrvhf1_mheart rate variability, high frequency 1 (mouse)Not determined3627608170276081Mouse
1301170Lith13_mlithogenic gene 13 (mouse)Not determined53633714470337256Mouse
1301524Lmb2_mlupus in MRL and B6 F2 cross (mouse)Not determined537424144112317856Mouse
13464246Ahl11_mage related hearing loss, early onset 11 (mouse)53748643571486554Mouse
1300951Gbvq1_mgallstone bladder volume QTL 1 (mouse)Not determined53795433971954456Mouse
13464245Ahl12_mage related hearing loss, early onset 12 (mouse)53795433971954456Mouse
1301698Pcfm4_mperiosteal circumference and femur length 4 (mouse)Not determined54442850078428622Mouse
13207584Mwmlpt4_mMorris water maze latency to platform, training, 4 (mouse)54616526380165263Mouse
13207588Mwmlpa4_mMorris water maze latency to platform, all, 4 (mouse)54616526380165263Mouse
14746981Manh57_mmandible shape 57 (mouse)54701239981012399Mouse
1300854Lmr3_mleishmaniasis resistance 3 (mouse)Not determined55253712081227149Mouse
11041665Lmr24_mleishmaniasis resistance 24 (mouse)552537120107173175Mouse
11041899Lmr24a_mleishmaniasis resistance 24a (mouse)552537120107173175Mouse
4142064Tmc1m4_mTmc1 modifier 4 (mouse)Not determined554342835126924008Mouse
1301243Bmd2_mbone mineral density 2 (mouse)Not determined555230992100307666Mouse
4142317Rgcs1_mretinal ganglion cell susceptible 1 (mouse)Not determined55230992108614761Mouse
13464248Ahl13_mage related hearing loss, early onset 13 (mouse)55548853189488652Mouse
10043962Obq27_mobesity QTL 27 (mouse)Not determined55612831290128312Mouse
10044005Ahl7_mage related hearing loss 7 (mouse)Not determined55816984192169980Mouse
11040589Lmr3a_mleishmaniasis resistance 3a (mouse)55945495493455133Mouse
11040590Lmr3b_mleishmaniasis resistance 3b (mouse)55945495493455133Mouse
11040591Lmr3c_mleishmaniasis resistance 3c (mouse)55945495493455133Mouse
11040592Lmr3d_mleishmaniasis resistance 3d (mouse)55945495493455133Mouse
1301843Listr1_mlisteriosis resistance 1 (mouse)Not determined56009823494098356Mouse
13464247Ahl14_mage related hearing loss, early onset 14 (mouse)56025521594255313Mouse
4142428Modvl1_mmodifier of vacuolated lens 1 (mouse)Not determined6250272196502841Mouse
1301010ahl2_mage related hearing loss 2 (mouse)Not determined56250272196502841Mouse
11252124Modvl6_mmodifier of vacuolated lens 6 (mouse)56250272196502841Mouse
13464250Ahl15_mage related hearing loss, early onset 15 (mouse)56250272196502841Mouse
10045972Tir5_mtrypanosome infection response 5 (mouse)Not determined563548099104239199Mouse
11049560Lmr24d_mleishmaniasis resistance 24d (mouse)56422703098227149Mouse
13207569Tcq13_mtotal cholesterol QTL 13 (mouse)959990000109260000Mouse
4141833W10q13_mweight 10 weeks QTL 13 (mouse)Not determined63332429120362868Mouse
4141545Tailaq2_mtail length adjusted QTL 2 (mouse)Not determined63332429120362868Mouse
1357635Splq4_mspleen weight QTL 4 (mouse)Not determined963332429120362868Mouse
1301725Lifespan1_mlife span 1 (mouse)Not determined974368177108368325Mouse
1302065El1_mepilepsy 1 (mouse)Not determined975775364114474379Mouse
10054492El7_mepilepsy 7 (mouse)Not determined975775364114474379Mouse
1301407Rapop2_mradiation-induced apoptosis 2 (mouse)Not determined976535936110536130Mouse
1301192Skts6_mskin tumor susceptibility 6 (mouse)Not determined978640645112640755Mouse
10401247Bglu14_mblood glucose level 14 (mouse)Not determined979397810113397888Mouse
1301732Char1_mP. chabaudi malaria resistance QTL 1 (mouse)Not determined981798268115798392Mouse
1300884Sluc11_msusceptibility to lung cancer 11 (mouse)Not determined982910333116910428Mouse
1357461Idd2_minsulin dependent diabetes susceptibility 2 (mouse)Not determined982910333116910428Mouse
10766454Char10_mP. chabaudi malaria resistance QTL 10 (mouse)982910333116910428Mouse
1301487Nociq1_mnociceptive sensitivity inflammatory QTL 1 (mouse)Not determined984528818118528921Mouse
10412180Msam3_mmuscle, skeletal, activity measure 3 (mouse)Not determined985897510108641186Mouse
1300549Bbaa17_mB. burgdorferi-associated arthritis 17 (mouse)Not determined986230401120230530Mouse
1302103Dob2_mdietary obesity 2 (mouse)Not determined986239845120289624Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
1357657Pymr_mPlasmodium yoelli malaria resistance (mouse)Not determined989977005118938021Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11081166Psl5_mpromotion susceptibility QTL 5 (mouse)994981301112872929Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 19654 UniSTS
UniSTS 112134 UniSTS