UniSTS:493167 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:493167

Symbol: UniSTS:493167
Also known as:
RGD ID: 5498122
Expected Size: 948 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38690,269,106 - 90,270,053UniSTSGRCm38
MGSCv37690,219,100 - 90,220,047UniSTSGRCm37
Celera692,162,757 - 92,163,704UniSTS
Cytogenetic Map6D1UniSTS
Is Marker For: Genes:   Vmn1r54  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGAATAAAATGAATAGACTGTCCCA
Reverse Primer TTACCTATTCCTGAGCAATATGAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1618222Vmn1r54vomeronasal 1 receptor 5469026910690270053Mouse

Nucleotide Sequences
RefSeq Transcripts NM_053224 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC122521 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC165969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF129005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF291488 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL456065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782630 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782631 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782632 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782633 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782634 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782635 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782636 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782637 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782638 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782639 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782640 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782641 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782642 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782643 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782644 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782645 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782646 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782647 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782648 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782649 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782650 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782651 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782652 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782653 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782654 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782655 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782656 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782657 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 113851 UniSTS
UniSTS 493167 UniSTS