UniSTS:493163 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:493163

Symbol: UniSTS:493163
Also known as:
RGD ID: 5498118
Expected Size: 933 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38690,223,408 - 90,224,340UniSTSGRCm38
GRCm38689,893,274 - 89,894,206UniSTSGRCm38
MGSCv37690,173,402 - 90,174,334UniSTSGRCm37
MGSCv37689,843,268 - 89,844,200UniSTSGRCm37
Celera691,801,211 - 91,802,143UniSTS
Celera692,112,709 - 92,113,641UniSTS
Cytogenetic Map6D1UniSTS
Is Marker For: Genes:   Vmn1r44   Vmn1r53  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGAATAAAGCCAACTTACTCCACAC
Reverse Primer TCAAATATTTACTATTCTGCCACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1609979Vmn1r44vomeronasal 1 receptor 4468989214489894206Mouse
1618208Vmn1r-ps28vomeronasal 1 receptor, pseudogene 2868990767789908618Mouse
1623265Vmn1r45vomeronasal 1 receptor 4568993165089940507Mouse
1618219Vmn1r46vomeronasal 1 receptor 4668997617189977100Mouse
3753466Vmn1r-ps29vomeronasal 1 receptor, pseudogene 2968999761390004592Mouse
1618227Vmn1r47vomeronasal 1 receptor 4769002188890022820Mouse
1618228Vmn1r48vomeronasal 1 receptor 4869003593390036841Mouse
3753464Vmn1r-ps31vomeronasal 1 receptor, pseudogene 3169005641290056690Mouse
1618401Vmn1r49vomeronasal 1, receptor 4969007208690073018Mouse
1618221Vmn1r50vomeronasal 1 receptor 5069010727590108207Mouse
1556966Vmn1r51vomeronasal 1 receptor 5169012264390130645Mouse
12436766Gm20426predicted gene 2042669013037190232837Mouse
2295119Vmn1r-ps32vomeronasal 1 receptor, pseudogene 3269015304790154002Mouse
1618224Vmn1r52vomeronasal 1 receptor 5269017871690179645Mouse
1618223V1ra8vomeronasal 1 receptor, A869020281790203656Mouse
1618220Vmn1r53vomeronasal 1 receptor 5369022331790224438Mouse

Nucleotide Sequences
RefSeq Transcripts NM_053226 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_053227 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB062899 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC080144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC122521 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC165969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF129005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF291491 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC125605 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC132002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC151088 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL456065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL589384 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL598167 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782714 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782715 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782716 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782717 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782718 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782719 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782720 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782721 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782723 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782724 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782725 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782726 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782727 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782728 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782729 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782730 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782731 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782732 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782733 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782734 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782735 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782736 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782737 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782738 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782739 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782740 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JF782741 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
14697704Stsl4_mSalmonella typhimurium susceptibility locus 4 (mouse)67710000090000000Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 113853 UniSTS
  113854 UniSTS
UniSTS 493163 UniSTS