UniSTS:491605 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:491605

Symbol: UniSTS:491605
Also known as:
RGD ID: 5497162
Expected Size: 1058 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm3810130,210,092 - 130,211,149UniSTSGRCm38
MGSCv3710129,647,148 - 129,648,205UniSTSGRCm37
Celera10132,584,832 - 132,585,889UniSTS
Cytogenetic Map10D3UniSTS
Is Marker For: Genes:   Olfr827  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AACCTGAAGCAGAAACTTGCC
Reverse Primer TGTAAATGGCAACGATCAGACAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1552801Olfr827olfactory receptor 82710130210160130211128Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
26884405Huml2_mhumerus length 2, 5 week (mouse)1069900000132500000Mouse
4142461Bmd25_mbone mineral density 25 (mouse)Not determined1097381196130694993Mouse
1357544Vtbt10_mvertebral trabecular bone trait 10 (mouse)Not determined1097381196130694993Mouse
11533919Mvb4_mmodifier of vibrator 4 (mouse)397381196130694993Mouse
11533921Mvb2_mmodifier of vibrator 2 (mouse)1097381196130694993Mouse
12880413V125Dq9_mvitamin D active form serum level QTL 9 (mouse)1097700000130694993Mouse
4141402T2dm1sa_mtype 2 diabetes mellitus 1 in SMXA RI mice (mouse)Not determined97922739130694993Mouse
11040593Lmr5e_mleishmaniasis resistance 5e (mouse)1099384730130694993Mouse
11040595Lmr5c_mleishmaniasis resistance 5c (mouse)1099384730130694993Mouse
11040597Lmr5a_mleishmaniasis resistance 5a (mouse)1099384730130694993Mouse
1301968Estq4_mestradiol regulated response QTL 4 (mouse)Not determined10101150611130694993Mouse
1357744Cfbw4_mcystic fibrosis body weight 4 (mouse)Not determined10101150611130694993Mouse
1301901Im5_mimmunoregulatory 5 (mouse)Not determined10101661259130694993Mouse
4141361Cfmq3_mcystic fibrosis modifier QTL 3 (mouse)Not determined10101661259130694993Mouse
1300678Leg2_mlongevity extending gene 2 (mouse)Not determined10102671003130694993Mouse
1301895Exq1_mexploratory and excitability QTL 1 (mouse)Not determined10103011947130694993Mouse
14696727Kidrq2_mkidney weight, right QTL 2 (mouse)10103066603130694993Mouse
4141007Obrq10_mobesity resistance QTL 10 (mouse)Not determined103407822130694993Mouse
4141487Tgq21_mtriglyceride QTL 21 (mouse)Not determined104274116130694993Mouse
14746996Manh69_mmandible shape 69 (mouse)10104927733130694993Mouse
1357482Nhdlq4_mnon-HDL QTL 4 (mouse)Not determined10105205399130694993Mouse
1300679Nociq2_mnociceptive sensitivity inflammatory QTL 2 (mouse)Not determined10105205399130694993Mouse
1302200Sle12_msystematic lupus erythematosus susceptibility 12 (mouse)Not determined10105205399130694993Mouse
11040594Lmr5f_mleishmaniasis resistance 5f (mouse)10105343808130694993Mouse
11040596Lmr5d_mleishmaniasis resistance 5d (mouse)10105343808130694993Mouse
11040598Lmr5b_mleishmaniasis resistance 5b (mouse)10105343808130694993Mouse
4142089Obrq9_mobesity resistance QTL 9 (mouse)Not determined108680038130694993Mouse
4141153Ltgq2_mliver triglyceride QTL 2 (mouse)Not determined108680038130694993Mouse
11039496Ltpr5b_mLeishmania tropica response 5b (mouse)10108739225130694993Mouse
11041664Lmr25_mleishmaniasis resistance 25 (mouse)10108739225130694993Mouse
11049563Lmr25a_mleishmaniasis resistance 25a (mouse)10108739225130694993Mouse
11049570Lmr25b_mleishmaniasis resistance 25b (mouse)10108739225130694993Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 258297 UniSTS
UniGene Mm.377419 UniSTS
UniSTS 491605 UniSTS