RH143879 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH143879

Symbol: RH143879
Also known as:
RGD ID: 5494297
Expected Size: 812 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38728,397,571 - 28,398,160UniSTSGRCm38
GRCm38870,525,017 - 70,525,828UniSTSGRCm38
MGSCv37873,048,916 - 73,049,727UniSTSGRCm37
MGSCv37729,182,590 - 29,183,179UniSTSGRCm37
Celera873,081,438 - 73,082,249UniSTS
Celera722,959,160 - 22,959,749UniSTS
Cytogenetic Map7A3UniSTS
Is Marker For: Genes:   Paf1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGTCTTCTGCAAGAGCAGCC
Reverse Primer TCCCCACTGAGCCATCTTAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1553781Paf1Paf1, RNA polymerase II complex component72839299628399383Mouse

Nucleotide Sequences
GenBank Nucleotide AC157774 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL591652 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1558870Eae36_mexperimental allergic encephalomyelitis susceptibility 36 (mouse)Not determined81472316071045600Mouse
1357811Orq3_movulation rate QTL 3 (mouse)Not determined83201654471287993Mouse
4141437W10q14_mweight 10 weeks QTL 14 (mouse)Not determined3201654471287993Mouse
4141172W6q9_mweight 6 weeks QTL 9 (mouse)Not determined3201654471287993Mouse
4140966Egq12_mearly growth QTL 12 (mouse)Not determined3201654471287993Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
10766466Char12_mP. chabaudi malaria resistance QTL 12 (mouse)86826982782600347Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1301572Sluc30_msusceptibility to lung cancer 30 (mouse)Not determined7269777136697919Mouse
1300722Sle3_msystemic lupus erythmatosus susceptibility 3 (mouse)Not determined7346321287493512Mouse
38501068Tip1_mtuberculosis immunophenotype 1, spleen CFU (mouse)7360000072900000Mouse
25314307Mlh1fc2_mMLH1 foci count 2 (mouse)76500000133900000Mouse
1357699Nhdlq6_mnon-HDL QTL 6 (mouse)Not determined71028944244289559Mouse
1558893Spir1_mStreptococcus pneumoniae infection resistance 1 (mouse)Not determined71060637344606511Mouse
10449139Eosn1_meosinophil differential 1 (mouse)71278145246781452Mouse
10449158Eosn3_meosinophil differential 3 (mouse)71278145246781452Mouse
4141566Femwf8_mfemur work to failure 8 (mouse)Not determined1333306047333196Mouse
11522751Cocia17_mcocaine-induced activity, QTL 17 (mouse)71343577947435779Mouse
25314314Sccor1_msynaptonemal complex length to mean MLH1 count ratio 1 (mouse)71360000047700000Mouse
1559016Drsi_mDCC-related Spp1 induction (mouse)Not determined71690336849509583Mouse
1301041Prnr2_mprion resistance 2 (mouse)Not determined71899486940024609Mouse
10412199Sst2_msusceptibility to tuberculosis 2 (mouse)Not determined718994869119886157Mouse
1301158Eae4_msusceptibility to experimental allergic encephalomyelitis 4 (mouse)Not determined719413473142366067Mouse
1301622Eae12_msusceptibility to experimental allergic encephalomyelitis 12 (mouse)Not determined71958059053580679Mouse
1301052Bhr6_mbronchial hyperresponsiveness 6 (mouse)Not determined72014282554142942Mouse
12904742Litsq2_mlitter size QTL 2 (mouse)72302446357024609Mouse
1301709Bdt4_mbone density traits 4 (mouse)Not determined72323914857239292Mouse
11354952Pdcc1_mplasmacytoid dentritic cell compartment 1 (mouse)72341710757417107Mouse
1301969Lbw5_mlupus NZB x NZW 5 (mouse)Not determined72719819161202351Mouse
7394747asp3_maudiogenic seizure prone 3 (mouse)Not determined72760637337142942Mouse
12790989Tgl6_mtriglyceride 6 (mouse)72789112561891125Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 54624 UniSTS
UniGene Mm.7916 UniSTS
UniSTS 233125 UniSTS