Sc4mol Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Sc4mol

Symbol: Sc4mol
Also known as:
RGD ID: 5134533
Expected Size: 164 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38864,719,102 - 64,720,425UniSTSGRCm38
Celera867,283,001 - 67,284,327UniSTS
Cytogenetic Map8B3.1UniSTS
cM Map832.3UniSTS
Is Marker For: Genes:   Msmo1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGGAATTGTGCTTTTGTGTG
Reverse Primer TCATGTGGTGGAAATCATGG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4948936 UniSTS
NCBI Gene 66234 UniSTS
UniGene Mm.30119 UniSTS
UniSTS 532566 UniSTS