Ftl1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Ftl1

Symbol: Ftl1
Also known as:
RGD ID: 5131231
Expected Size: 56 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map7B4UniSTS
cM Map729.32UniSTS
Is Marker For: Genes:   Ftl1   Ftl1-ps2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGGGCCTCCTACACCTACCT
Reverse Primer GCCACGTCATCCCGATCA
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_010240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003688879 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003689208 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003945687 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003945688 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_486478 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC092480 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC092481 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC092855 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC114901 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC116121 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC151602 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC154650 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC159970 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC183093 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC226737 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL627328 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL645948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL954855 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY418691 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC019840 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC081462 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC083350 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC085309 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC092259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC106145 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC106146 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC150761 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH466719 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CR195513 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CR211424 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CT009486 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CU442723 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CZ404230 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FR146966 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FR279155 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL589784 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL591187 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL591750 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL596749 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL606408 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J04716 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L39879 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M73706 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
MGD MGI:4944085 UniSTS
NCBI Gene 100862446 UniSTS
  14325 UniSTS
  434624 UniSTS
UniGene Mm.30357 UniSTS
  Mm.348374 UniSTS
  Mm.425988 UniSTS
  Mm.431913 UniSTS
  Mm.486189 UniSTS
UniSTS 532424 UniSTS