D1S1425 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1S1425

Symbol: D1S1425
Also known as: GDB:330277; 
RGD ID: 5109281
Expected Size: 171 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map1p33UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map1p31.3UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic Map9q34.3UniSTS
Cytogenetic Map6q25.3UniSTS
Cytogenetic Map19p13.12UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic Map2p13.1UniSTS
Cytogenetic Map5q35.3UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map4q21.23UniSTS
Cytogenetic Map22q12.1UniSTS
Cytogenetic Map8q24.13UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map1q23.1UniSTS
Cytogenetic Map10q22UniSTS
Cytogenetic Map4q12UniSTS
Cytogenetic Map10p14UniSTS
Cytogenetic Map6p21.33UniSTS
Cytogenetic Map10q26.3UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map7p22.2UniSTS
Cytogenetic Map12q13.12UniSTS
Cytogenetic Map18p11.21UniSTS
Cytogenetic Map14q32.12UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map18p11.31UniSTS
Cytogenetic Map13q34UniSTS
Cytogenetic Map4p14UniSTS
Cytogenetic Map8p23.1UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map3q21.3UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map8q12.1UniSTS
Cytogenetic Map11q12.3UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map10p12UniSTS
Cytogenetic Map12q13UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map8q24UniSTS
Cytogenetic Map2p23.3UniSTS
Cytogenetic Map5q13.2UniSTS
Cytogenetic Map5q32UniSTS
Cytogenetic Map1q21.2UniSTS
Cytogenetic Map3q26.2UniSTS
Cytogenetic Map6q25.2-q25.3UniSTS
Cytogenetic Map20q11.2-q13.2UniSTS
Cytogenetic Map12q13.3UniSTS
Cytogenetic Map1q21-q23UniSTS
Cytogenetic Map17q21.32UniSTS
Cytogenetic Map1p35.3UniSTS
Cytogenetic Map1p12UniSTS
Cytogenetic Map2p23-p22UniSTS
Cytogenetic Map2q36.1UniSTS
Cytogenetic Map11q23.3UniSTS
Cytogenetic Map2p16.1UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map16q12.1UniSTS
Cytogenetic Map17q22-q23UniSTS
Cytogenetic Map2p11.1UniSTS
Cytogenetic Map16q12.2UniSTS
Cytogenetic Map2p12-p11.2UniSTS
Cytogenetic Map3q11.1UniSTS
Cytogenetic Map2p21UniSTS
Cytogenetic Map17q11.2-q12UniSTS
Cytogenetic Map2q37.1UniSTS
Cytogenetic Map1p32-p31UniSTS
Cytogenetic Map1p21.3UniSTS
Cytogenetic Map1q32.2UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map7q21-q22UniSTS
Cytogenetic Map1q25.3UniSTS
Cytogenetic Map18p11.3-p11.2UniSTS
Cytogenetic Map2q33.2UniSTS
Cytogenetic Map20q13.13UniSTS
Cytogenetic Map21p11.1UniSTS
Cytogenetic Map12q24.31-q24.32UniSTS
Cytogenetic Map9q33.2UniSTS
Cytogenetic Map11q13.5UniSTS
Cytogenetic Map12p12.2-p11.2UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic Map19p13.3-p13.2UniSTS
Cytogenetic Map7q32.1UniSTS
Cytogenetic Map8p21.3UniSTS
Cytogenetic Map17q22-q23.2UniSTS
Cytogenetic Map3q27.1UniSTS
Cytogenetic Map11q13.1UniSTS
Cytogenetic Map4q21.21UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map14q32UniSTS
Cytogenetic Map14q24.2UniSTS
Cytogenetic Map20q13.33UniSTS
Cytogenetic Map3p21UniSTS
Cytogenetic Map10p11.23UniSTS
Cytogenetic Map1p35.1UniSTS
Cytogenetic Map1q25.2UniSTS
Cytogenetic Map18q12.1UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map2q11.2UniSTS
Cytogenetic Map15q23UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map13q12.11UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic Map3q21.1UniSTS
Cytogenetic Map12p12UniSTS
Cytogenetic Map21q22.11UniSTS
Cytogenetic Map15q15.3UniSTS
Cytogenetic MapXq12-q13UniSTS
Cytogenetic Map22q11.2UniSTS
Cytogenetic Map7q31.1-q31.3UniSTS
Cytogenetic MapXp22.11UniSTS
Cytogenetic Map3p21.1-p14.2UniSTS
Cytogenetic Map2p24UniSTS
Cytogenetic Map20p12.1UniSTS
Cytogenetic Map3q26.33UniSTS
Cytogenetic Map12q13.11-q14.3UniSTS
Cytogenetic Map2q37.3UniSTS
Cytogenetic Map9q21.33UniSTS
Cytogenetic Map12q12UniSTS
Cytogenetic MapXq13-q21UniSTS
Cytogenetic Map8q24.22UniSTS
Cytogenetic Map11p13UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map6q25.2-q27UniSTS
Cytogenetic Map12q24.32UniSTS
Cytogenetic Map15q22.31UniSTS
Cytogenetic MapXq13.1UniSTS
Cytogenetic Map22q12.2UniSTS
Cytogenetic Map14q12UniSTS
Cytogenetic Map12q23-q24.1UniSTS
Cytogenetic Map4q35.1UniSTS
Cytogenetic Map17q24.1UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map14q21UniSTS
Cytogenetic Map9p24.3UniSTS
Cytogenetic Map7p13UniSTS
Cytogenetic Map2p14UniSTS
Cytogenetic Map21q22.2UniSTS
Cytogenetic Map2q12.3UniSTS
Cytogenetic Map8p21.1UniSTS
Cytogenetic Map17p13.2UniSTS
Cytogenetic Map3q25.33UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map1p34UniSTS
Cytogenetic Map19p13.1UniSTS
Cytogenetic Map5q14.1UniSTS
Cytogenetic MapXq22.3UniSTS
Cytogenetic Map7p21.1UniSTS
Cytogenetic Map6p25.2UniSTS
Cytogenetic Map10q23.33UniSTS
Cytogenetic Map15q11-q12UniSTS
Cytogenetic Map3p22.2UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map15q21.1-q21.2UniSTS
Cytogenetic Map6p21.3UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map4q13.3UniSTS
Cytogenetic Map19p13.13UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map17q24.3UniSTS
Cytogenetic Map12p13.33UniSTS
Cytogenetic Map11q14.1UniSTS
Cytogenetic Map3p22-p21.3UniSTS
Cytogenetic Map16q22.3UniSTS
Cytogenetic Map1p22.1UniSTS
Cytogenetic Map6p12.1UniSTS
Cytogenetic Map19q13.33-q13.41UniSTS
Cytogenetic Map2p25.3UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map5p12UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map7q35UniSTS
Cytogenetic Map17p12UniSTS
Cytogenetic Map7q11.1UniSTS
Cytogenetic Map2p25.1-p24.1UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map4q31.21UniSTS
Cytogenetic Map5p13.1UniSTS
Cytogenetic MapXq22.1UniSTS
Cytogenetic Map9q21.11UniSTS
Cytogenetic Map5q13UniSTS
Cytogenetic Map1p22.2UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map12q24UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic Map1q24.2UniSTS
Cytogenetic Map22q13.31UniSTS
Cytogenetic Map8p11.23UniSTS
Cytogenetic Map1q23.3UniSTS
Cytogenetic Map16p12UniSTS
Cytogenetic Map10p15-p14UniSTS
Cytogenetic Map19q13UniSTS
Cytogenetic Map1q22-q23UniSTS
Cytogenetic Map20q11.23UniSTS
Cytogenetic Map7q31UniSTS
Cytogenetic Map10q26UniSTS
Cytogenetic Map7p22.1UniSTS
Cytogenetic Map6p22.3UniSTS
Cytogenetic Map6p21.2UniSTS
Cytogenetic Map11q13.4UniSTS
Cytogenetic Map11q24.2UniSTS
Cytogenetic MapXq28UniSTS
Cytogenetic Map1p33-p32UniSTS
Cytogenetic Map5q35.2UniSTS
Cytogenetic Map3p14.3UniSTS
Cytogenetic Map12q24.33UniSTS
Cytogenetic Map3q26.1-q26.2UniSTS
Cytogenetic Map12p13UniSTS
Cytogenetic Map7q36.1UniSTS
Cytogenetic Map8p11.21UniSTS
Cytogenetic Map12q13.1-q13.2UniSTS
Cytogenetic Map1p36.11UniSTS
Cytogenetic Map19q13.33UniSTS
Cytogenetic Map16p12.3UniSTS
Cytogenetic Map13q14.11UniSTS
Cytogenetic Map9p13.2UniSTS
Cytogenetic Map4q22.1UniSTS
Cytogenetic Map3q13.2UniSTS
Cytogenetic Map8p22UniSTS
Cytogenetic Map22q11.23UniSTS
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map1q42.3UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map5q12.3UniSTS
Cytogenetic Map20q11.21UniSTS
Cytogenetic Map9q34.11UniSTS
Cytogenetic Map12q14.3UniSTS
Cytogenetic Map6q15UniSTS
Cytogenetic Map6q22.32UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map16p13.11UniSTS
Cytogenetic Map10q24.32UniSTS
Cytogenetic Map4p16.1UniSTS
Cytogenetic Map18q11.1UniSTS
Cytogenetic Map16q23.2UniSTS
Cytogenetic Map3q12.1UniSTS
Cytogenetic Map15q24-q25UniSTS
Cytogenetic Map7q31.1UniSTS
Cytogenetic Map15q26.1UniSTS
Cytogenetic Map8q13.1UniSTS
Cytogenetic Map6pter-p12.1UniSTS
Cytogenetic Map6q16UniSTS
Cytogenetic Map12q14.1UniSTS
Cytogenetic Map17q21.2UniSTS
Cytogenetic Map9q22.2UniSTS
Cytogenetic Map17q23.2UniSTS
Cytogenetic Map11q23.1-q23.2UniSTS
Cytogenetic Map13q14UniSTS
Cytogenetic Map4q23UniSTS
Cytogenetic Map16p12.2UniSTS
Cytogenetic Map11q24.3UniSTS
Cytogenetic Map7p14UniSTS
Cytogenetic Map15q24.1UniSTS
Cytogenetic Map16q24.2UniSTS
Cytogenetic Map12q13.11UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map8q22.1UniSTS
Cytogenetic Map6q16.2UniSTS
Cytogenetic Map5p15.2UniSTS
Cytogenetic Map20q13.12UniSTS
Cytogenetic Map14q22.3UniSTS
Cytogenetic Map2q13UniSTS
Cytogenetic Map3p21.3UniSTS
Cytogenetic Map12q13.2UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic Map3q29UniSTS
Cytogenetic Map5q23.3-q31.1UniSTS
Cytogenetic Map1p36UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map2q35UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic Map1p34.2UniSTS
Cytogenetic Map12p13.31UniSTS
Cytogenetic Map3q12.3UniSTS
Cytogenetic Map11q23UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map17q25.3UniSTS
Cytogenetic Map20q11UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map5q23.3UniSTS
Cytogenetic Map15q15.1UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic Map1q42UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map12q24.13UniSTS
Cytogenetic Map3q27.3UniSTS
Cytogenetic Map14q21.3UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map2p15UniSTS
Cytogenetic Map17q22UniSTS
Cytogenetic Map20q13.32UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic MapXq21.1UniSTS
Is Marker For: Genes:   SLC8A1   STAT5B   PRKN   PSMB2   RGS12   OSBPL1A   AVIL   STX6   FUT9   DYNLT1   PHKA1   CTSB   CD4   PRKCA   SLC16A1   SPN   ARNTL2   IRF1   DNASE1   SAG   SLC11A1   RAB3B   PTGIS   SYNJ2BP   FGFR2   SLCO2B1   F2RL1   GCLM   ATP1B4   PDE4C   GLG1   PTPN2   SIRT2   APBA2   TIMM17A   PRELP   AKAP11   LTBP3   HES2   PSMD9   ABCB9   MYT1L   UPB1   GNE   QTRT1   AKR1B1   MAP3K12   CACNB2   SLC2A13   ATP7A   SYNGR2   ABCC3   CENPI   P3H4   NF2   RASGRP3   SLC5A5   KREMEN1   ALDH3A1   DDIT3   RACK1   CSAD   ACAA1   SFTPB   NEDD8   AKAP13   P2RX4   GRM4   KIAA0930   TRAF3IP2   GGA2   RBMS2   HAUS3   LAMTOR5   CDKL1   ATF6   PMS2   RASSF2   SLC37A2   CEP76   TATDN1   IRAK4   IFT22   IFNAR1   DENND2A   ATP6V0D1   EIF5A2   PCMTD2   HSH2D   TAF1A   LIMS1   AGPAT3   RIN3   ESF1   SFXN2   APPBP2   H6PD   SPTLC1   CBX5   HACD2   SH3YL1   MRPL10   ZNHIT3   SYMPK   RNF125   KIN   PIWIL2   ERCC1   PSME3   ORAI2   KDM2B   OTUB1   OPA3   COPS5   ABHD2   KCTD6   GRTP1   CNPY3   PAPOLG   GOLM1   KPNA4   SLC25A15   FFAR4   DMBX1   MDM4   ATCAY   RALGPS2   RHBDL2   SSR2   FIP1L1   SSH2   MAP3K14   CNRIP1   DDHD2   TAF8   PSMD5   STX16   CPM   SMYD4   CIPC   RPS6KL1   ZNF7   POLD4   ECT2   MRPL44   KDM1B   DNAL1   TRMT10B   KLHL6   LUC7L   FBXO4   NACA   SNTB2   LRRC27   MNT   MTPAP   PLCD3   CD3G   EXOSC6   FGD2   TCOF1   CATSPERG   SEC62   TMOD3   PM20D2   GAB1   ZNF626   PTPN14   AKTIP   PPP1R15B   NSD2   PNPT1   CBFA2T2   RBM7   TRBV27   TINAG   LY6G5C   ZNF517   PIP5KL1   ARHGAP27   PMPCA   ZNF75A   ATAD3B   CPAMD8   C21orf62-AS1   VSIG1   PTBP2   STAT2   LAMB4   PDHB   UGGT1   SNX29P1   BEST1   THADA   INPP5B   OAZ2   BAGE   ZNF417   ZNF215   RAB22A   NONO   STK4   PDK3   SFXN5   ARFGAP3   EMSY   DUOX1   TBC1D12   PLEKHA5   IL10RB   ZFP82   SMURF2   ZMYM6   ANKMY1   SCAMP4   PKD1L2   TMEM217   ACOX1   GPI   B3GALNT2   PEX5L   ZNF557   PARP14   PPP1R3B   LY6K   PGPEP1   ZNF286A   GAL3ST4   DOCK7   CTTN   LETM1   PCNX1   BHMT2   RLIM   SNX29P2   MSI2   CNTNAP2   SREK1   FBXL18   ZNF266   TNFSF14   GOLGA4   ELMOD3   NXPE3   PAN2   RNF114   GJC1   ZNF101   ABCB5   TRIM52   SERAC1   NSUN3   SIAH1   PHACTR4   MAP2K7   SP2   PLA2G4C   SLC27A5   DENR   APOL1   ZNF638   TGOLN2   BPIFA2   C6orf89   GIMAP1   METTL2B   MEG3   YEATS2   NUMB   ZNF99   E2F2   AMD1   CHCHD7   ARHGAP28   LINC00114   GPSM2   SIGLEC8   IL12RB1   CNN2   TMEM41B   SYNRG   ALDH16A1   PRRC2C   SH2D3A   PLEKHG2   RNF103   ZNF114   AP4S1   EMID1   SUMF2   SCN3B   TMEM39B   POFUT1   PPM1K   WDR19   LRPAP1   SEMA4C   OR7D2   MPV17   KTN1-AS1   RUBCN   ZNF277   TINF2   PHLDB1   MTX3   ISG20L2   DHRS7B   CSGALNACT1   CCDC122   ZNF785   LYRM7   TSPAN5   TMEM91   DNAJC22   FRMD8   SNHG7   OGFOD3   C17orf75   LRTOMT   IDO2   TMEM169   INTS11   APIP   TMEM116   CCDC62   MPHOSPH8   LRWD1   IFNLR1   NCOA7   SH2B1   RNF207   CCDC88B   RBFOX3   NAA38   GLS2   CCL5   RICTOR   POLR2J2   PGAM5   LBHD1   VKORC1   UNKL   UQCRQ   CLCC1   FXN   SCIMP   ANKDD1A   DAGLB   FOXK1   ABRAXAS1   BMP2K   CDK11A   MYLK4   COX18   ITPRIPL2   DBF4B   NBAS   FILIP1L   DLEC1   CAMK2G   SLC27A1   VMA21   ZDHHC8P1   CLNK   CCDC32   UBOX5   DLGAP4   ZFP30   MKNK1   EPB41   CCDC30   MFSD4A   LRRC36   OGFOD1   TPM3   SNORA17B   MTRFR   METTL8   GATAD1   KIAA1614   PBRM1   RNF14   OTUD6A   PHF20L1   POLR1G   ACSM2A   CEP20   CCDC120   CCDC142   MAVS   ATXN3   GK5   PAQR7   PLA2G4E   SPECC1   CYP20A1   LRRC49   PDE12   FAM131A   IRGQ   CYB5D2   ITIH5   NOC2L   LRRC8B   POLR2J3   SPICE1   ZXDC   HILPDA   GPR161   CLEC4GP1   ZNF737   UCKL1-AS1   NUGGC   GGT8P   FAM153B   ZNF829   C17orf99   ZNF844   PLEKHM1P1   GTF2H2C   ZNF841   RPS10P7   RPL23AP64   TRABD2A   CCDC159   DSTNP2   CARMN   FGD5-AS1   DNAJC27-AS1   PRICKLE2-AS3   PCBP1-AS1   PCED1B-AS1   TSTD3   LOXL1-AS1   LINC00608   RASA4CP   PPP5D1P   LINC00663   ILF3-DT   LINC00664   LINC00910   ZNRD2-DT   MAN1B1-DT   LINC00895  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGAGGTCAGGAGTTCAAGACC
Reverse Primer ATCTCGGCTCACTGCAATCT
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_000073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000268 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000453 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000629 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000961 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001005502 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001007561 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001009880 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001010906 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001017980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001032999 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001034841 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001037165 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001039570 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001039709 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001040151 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001040653 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001043351 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001043352 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001043353 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001044387 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001044388 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001048183 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001076675 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001080383 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001098728 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001098786 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001114182 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001127321 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001127322 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001130820 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001130821 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001130822 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001130842 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001134456 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001134476 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001135721 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001136499 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001142310 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001142311 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001142312 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001143757 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001144913 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001144919 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001145256 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001145257 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001145258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001145408 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001145409 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001145410 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001159293 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001162900 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001163544 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001163545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001163546 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001163547 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001163941 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001166005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001166007 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001166049 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001874 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001908 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001983 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_002061 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_002198 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_002725 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_002737 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_002898 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_002926 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_002985 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_003677 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_004285 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_004437 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_004562 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_005093 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_005242 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_005497 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_006282 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_006455 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_006581 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_006750 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_007011 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_007247 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_007363 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_012099 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_012117 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_012318 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_013332 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_013987 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_013988 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_014252 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_014402 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_014898 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_015264 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_015350 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_015352 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_015989 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_016120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_016123 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_016418 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_017712 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_017821 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_017831 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018068 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018109 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018233 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018373 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018400 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_019089 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_020120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_020390 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_020652 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_020673 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_020950 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_021994 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_022777 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_022835 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_022915 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_023923 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_024341 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_024511 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_024637 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_024770 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_024902 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_024963 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_025136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_030626 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_030980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_031904 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_032779 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_032833 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_033064 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_033426 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_052928 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_079834 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_080550 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_130446 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_133334 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_138390 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_138572 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_144600 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_144611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_144964 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_145037 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_147192 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_147780 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_147781 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_147782 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_147783 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_152475 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_152734 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_152924 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_153608 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_153649 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_172225 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_173827 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_177538 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_177966 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_178324 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_178559 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_178858 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181425 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181644 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181705 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181828 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181829 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181830 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181832 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181833 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_183353 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_198229 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_198320 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_198580 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_198882 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_201348 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_203342 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_203343 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_207320 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB007955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB014731 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB020667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB023147 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB023212 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB032984 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB033094 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB033099 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB037720 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB037735 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB046832 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB046834 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB046858 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB051441 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB051524 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF006199 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF019225 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF030111 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF035364 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF036581 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF038554 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF064090 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF071594 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF090893 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF090930 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF090931 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF103800 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF116545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF116547 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF116548 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF126109 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF131796 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF136407 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF147304 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF158383 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF158384 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF195092 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF223403 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF256215 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF260700 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF302785 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF323540 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF339805 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ250583 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK000182 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK000397 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK000791 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK000930 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001003 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001054 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001092 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001106 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001107 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001213 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001308 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001526 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001926 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001957 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK001998 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK002019 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK002166 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021463 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021589 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021603 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021620 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021623 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021652 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021665 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021686 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021690 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021700 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021898 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021901 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021937 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022034 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022062 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022178 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022179 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022206 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022225 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022252 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022356 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022426 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022448 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022583 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022670 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022685 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022733 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022763 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK022947 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023149 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023166 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023298 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023305 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023309 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023312 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023333 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023363 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023458 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023535 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023571 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023680 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023754 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023790 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023822 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023852 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023944 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK023947 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024052 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024067 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024139 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024160 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024179 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024182 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024201 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024276 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024314 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024368 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024378 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024456 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024520 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024602 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024625 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024729 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024737 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024947 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025047 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025051 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025112 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025177 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025188 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025218 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025420 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025597 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025661 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025704 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK025908 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026059 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026127 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026508 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026669 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026675 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026915 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026970 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK026974 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK027013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK027088 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL110164 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL137282 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL137543 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL137592 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL157428 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL162045 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL353939 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY007107 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC000150 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC000969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC001863 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC001903 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC002364 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC002465 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC004228 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC005967 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC006426 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC007085 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D00591 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D14545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D14872 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D16561 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D16583 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D26067 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D28126 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D90086 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J00087 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J00098 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J03069 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J03071 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J03764 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J04970 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  K03021 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L05367 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L06849 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L11910 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L17684 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L17892 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L18033 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L18499 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L20346 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L30161 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L34162 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L34545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L35930 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L39062 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M10065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M11567 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M13254 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M13792 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M14949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M15205 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M17262 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M19482 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M20902 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M26434 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M27132 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M29929 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M29930 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M30688 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M32723 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M33320 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M37712 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M57450 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M57678 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M59783 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M60806 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63480 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63543 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63544 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63796 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M76423 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M76741 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M81890 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M85145 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M87914 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M88003 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M88553 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M90058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M91036 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M91037 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M96326 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M97911 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M99412 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S72393 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S75313 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S79267 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U01317 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U02493 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U03874 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U04819 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U07000 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U07561 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U07562 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U07563 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U08988 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U10580 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U11270 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U12821 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U14573 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U14574 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U14706 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U17084 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U47621 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U67058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U72518 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U86751 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X01392 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X01463 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X03120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X05322 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X12458 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X12544 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X14448 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X15723 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X16289 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X54048 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X54156 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X54171 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X54486 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X55448 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X57103 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X58045 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X60459 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X60653 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X64467 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X65032 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X68793 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X69907 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X69951 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X70872 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X71875 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X74871 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X74984 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X77337 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X77738 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X78212 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X78673 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X82817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X82818 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z15025 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z15026 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z15027 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z17227 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z23091 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z35127 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z46936 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z47046 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 100113386 UniSTS
  100128130 UniSTS
  100129075 UniSTS
  100129112 UniSTS
  100129502 UniSTS
  100129842 UniSTS
  100130027 UniSTS
  100130157 UniSTS
  100130370 UniSTS
  100130581 UniSTS
  100130654 UniSTS
  100130744 UniSTS
  100130890 UniSTS
  100131150 UniSTS
  100131756 UniSTS
  100131822 UniSTS
  100132183 UniSTS
  100132815 UniSTS
  100141515 UniSTS
  10020 UniSTS
  100233209 UniSTS
  100287221 UniSTS
  100287616 UniSTS
  100289019 UniSTS
  100289341 UniSTS
  100310756 UniSTS
  10045 UniSTS
  100505641 UniSTS
  100506012 UniSTS
  100506385 UniSTS
  100506776 UniSTS
  100507431 UniSTS
  100507556 UniSTS
  10052 UniSTS
  100652758 UniSTS
  100652781 UniSTS
  100874243 UniSTS
  10098 UniSTS
  10166 UniSTS
  10179 UniSTS
  10197 UniSTS
  10228 UniSTS
  10399 UniSTS
  10440 UniSTS
  10513 UniSTS
  10542 UniSTS
  10558 UniSTS
  10609 UniSTS
  10618 UniSTS
  10677 UniSTS
  10690 UniSTS
  10695 UniSTS
  10758 UniSTS
  10781 UniSTS
  10849 UniSTS
  10987 UniSTS
  10998 UniSTS
  11057 UniSTS
  11154 UniSTS
  11179 UniSTS
  11214 UniSTS
  11215 UniSTS
  11259 UniSTS
  11276 UniSTS
  113026 UniSTS
  11309 UniSTS
  113178 UniSTS
  114134 UniSTS
  114780 UniSTS
  114826 UniSTS
  114876 UniSTS
  116449 UniSTS
  118460 UniSTS
  118980 UniSTS
  123745 UniSTS
  123811 UniSTS
  123876 UniSTS
  124540 UniSTS
  124936 UniSTS
  124995 UniSTS
  126075 UniSTS
  126133 UniSTS
  126298 UniSTS
  1265 UniSTS
  127343 UniSTS
  129080 UniSTS
  129293 UniSTS
  129685 UniSTS
  131408 UniSTS
  135112 UniSTS
  135293 UniSTS
  1368 UniSTS
  138429 UniSTS
  139562 UniSTS
  140683 UniSTS
  140890 UniSTS
  146540 UniSTS
  146713 UniSTS
  147687 UniSTS
  147727 UniSTS
  148789 UniSTS
  148808 UniSTS
  150185 UniSTS
  150244 UniSTS
  1508 UniSTS
  151300 UniSTS
  152185 UniSTS
  152926 UniSTS
  158234 UniSTS
  160857 UniSTS
  162073 UniSTS
  162998 UniSTS
  163071 UniSTS
  163702 UniSTS
  164091 UniSTS
  1649 UniSTS
  169355 UniSTS
  170575 UniSTS
  171220 UniSTS
  1773 UniSTS
  1870 UniSTS
  1894 UniSTS
  192111 UniSTS
  199777 UniSTS
  200845 UniSTS
  201176 UniSTS
  201562 UniSTS
  201626 UniSTS
  2017 UniSTS
  202134 UniSTS
  202181 UniSTS
  2035 UniSTS
  203547 UniSTS
  2067 UniSTS
  2150 UniSTS
  218 UniSTS
  219855 UniSTS
  220074 UniSTS
  221468 UniSTS
  221472 UniSTS
  221477 UniSTS
  221656 UniSTS
  221937 UniSTS
  221955 UniSTS
  222229 UniSTS
  2263 UniSTS
  22798 UniSTS
  22835 UniSTS
  22839 UniSTS
  22888 UniSTS
  22926 UniSTS
  22933 UniSTS
  22944 UniSTS
  22990 UniSTS
  23040 UniSTS
  23062 UniSTS
  231 UniSTS
  23155 UniSTS
  23187 UniSTS
  23203 UniSTS
  23215 UniSTS
  23232 UniSTS
  23259 UniSTS
  23313 UniSTS
  23432 UniSTS
  23439 UniSTS
  23457 UniSTS
  23468 UniSTS
  23507 UniSTS
  23509 UniSTS
  23743 UniSTS
  2395 UniSTS
  246721 UniSTS
  2491 UniSTS
  253260 UniSTS
  254100 UniSTS
  2549 UniSTS
  256356 UniSTS
  25780 UniSTS
  25870 UniSTS
  25927 UniSTS
  25970 UniSTS
  25979 UniSTS
  26047 UniSTS
  26155 UniSTS
  262 UniSTS
  26272 UniSTS
  26277 UniSTS
  26286 UniSTS
  26751 UniSTS
  27089 UniSTS
  27147 UniSTS
  27151 UniSTS
  27165 UniSTS
  27181 UniSTS
  27283 UniSTS
  2730 UniSTS
  27332 UniSTS
  2734 UniSTS
  2803 UniSTS
  2821 UniSTS
  283218 UniSTS
  283234 UniSTS
  283357 UniSTS
  284072 UniSTS
  284371 UniSTS
  284391 UniSTS
  284406 UniSTS
  284440 UniSTS
  284454 UniSTS
  285521 UniSTS
  28560 UniSTS
  2914 UniSTS
  29766 UniSTS
  29899 UniSTS
  29923 UniSTS
  30 UniSTS
  321 UniSTS
  338557 UniSTS
  340156 UniSTS
  340273 UniSTS
  340385 UniSTS
  340547 UniSTS
  3454 UniSTS
  345778 UniSTS
  348094 UniSTS
  3588 UniSTS
  3594 UniSTS
  3633 UniSTS
  3659 UniSTS
  374899 UniSTS
  376497 UniSTS
  376693 UniSTS
  3840 UniSTS
  388325 UniSTS
  388591 UniSTS
  389641 UniSTS
  389643 UniSTS
  3954 UniSTS
  3987 UniSTS
  400680 UniSTS
  400866 UniSTS
  400960 UniSTS
  401331 UniSTS
  401490 UniSTS
  4043 UniSTS
  4054 UniSTS
  4194 UniSTS
  4287 UniSTS
  4335 UniSTS
  4358 UniSTS
  440026 UniSTS
  440352 UniSTS
  440456 UniSTS
  440508 UniSTS
  442122 UniSTS
  4666 UniSTS
  4738 UniSTS
  4771 UniSTS
  4841 UniSTS
  4947 UniSTS
  5025 UniSTS
  5071 UniSTS
  51 UniSTS
  51074 UniSTS
  51105 UniSTS
  51132 UniSTS
  51135 UniSTS
  51280 UniSTS
  51281 UniSTS
  51380 UniSTS
  5143 UniSTS
  51555 UniSTS
  51575 UniSTS
  51594 UniSTS
  5162 UniSTS
  5165 UniSTS
  51691 UniSTS
  51733 UniSTS
  5255 UniSTS
  538 UniSTS
  53905 UniSTS
  5395 UniSTS
  54067 UniSTS
  54477 UniSTS
  54625 UniSTS
  54626 UniSTS
  54737 UniSTS
  54742 UniSTS
  54839 UniSTS
  54858 UniSTS
  548644 UniSTS
  54910 UniSTS
  54933 UniSTS
  54941 UniSTS
  54973 UniSTS
  55103 UniSTS
  55116 UniSTS
  55124 UniSTS
  55149 UniSTS
  55193 UniSTS
  55239 UniSTS
  55251 UniSTS
  55282 UniSTS
  55333 UniSTS
  55384 UniSTS
  5549 UniSTS
  55589 UniSTS
  55611 UniSTS
  55689 UniSTS
  55692 UniSTS
  5578 UniSTS
  55790 UniSTS
  55798 UniSTS
  55800 UniSTS
  55905 UniSTS
  5609 UniSTS
  56648 UniSTS
  56886 UniSTS
  56894 UniSTS
  5690 UniSTS
  56938 UniSTS
  56946 UniSTS
  5711 UniSTS
  5715 UniSTS
  57335 UniSTS
  574 UniSTS
  5740 UniSTS
  57403 UniSTS
  57404 UniSTS
  57506 UniSTS
  5771 UniSTS
  57710 UniSTS
  57728 UniSTS
  57798 UniSTS
  57804 UniSTS
  57828 UniSTS
  5784 UniSTS
  58155 UniSTS
  5865 UniSTS
  5939 UniSTS
  6002 UniSTS
  6295 UniSTS
  6352 UniSTS
  63892 UniSTS
  63899 UniSTS
  64149 UniSTS
  641649 UniSTS
  6439 UniSTS
  64400 UniSTS
  645367 UniSTS
  64718 UniSTS
  64750 UniSTS
  6477 UniSTS
  64792 UniSTS
  64857 UniSTS
  64895 UniSTS
  649946 UniSTS
  65080 UniSTS
  6528 UniSTS
  6546 UniSTS
  6556 UniSTS
  6566 UniSTS
  65979 UniSTS
  6645 UniSTS
  6668 UniSTS
  6693 UniSTS
  6746 UniSTS
  6773 UniSTS
  6777 UniSTS
  677824 UniSTS
  6789 UniSTS
  6949 UniSTS
  6993 UniSTS
  7095 UniSTS
  7170 UniSTS
  728264 UniSTS
  728340 UniSTS
  728621 UniSTS
  728642 UniSTS
  729652 UniSTS
  729723 UniSTS
  7439 UniSTS
  7468 UniSTS
  7553 UniSTS
  7627 UniSTS
  7652 UniSTS
  7762 UniSTS
  7786 UniSTS
  783 UniSTS
  7844 UniSTS
  79001 UniSTS
  79081 UniSTS
  79145 UniSTS
  79230 UniSTS
  79364 UniSTS
  79441 UniSTS
  79660 UniSTS
  79667 UniSTS
  79690 UniSTS
  79701 UniSTS
  79774 UniSTS
  79822 UniSTS
  79828 UniSTS
  79890 UniSTS
  79959 UniSTS
  79962 UniSTS
  80028 UniSTS
  80174 UniSTS
  80207 UniSTS
  80228 UniSTS
  80313 UniSTS
  80741 UniSTS
  80760 UniSTS
  81608 UniSTS
  818 UniSTS
  81875 UniSTS
  8189 UniSTS
  81890 UniSTS
  83544 UniSTS
  83694 UniSTS
  83786 UniSTS
  83858 UniSTS
  83940 UniSTS
  83999 UniSTS
  84142 UniSTS
  84173 UniSTS
  84660 UniSTS
  84678 UniSTS
  84851 UniSTS
  84865 UniSTS
  84919 UniSTS
  84941 UniSTS
  84947 UniSTS
  84973 UniSTS
  85300 UniSTS
  85368 UniSTS
  8542 UniSTS
  85440 UniSTS
  85457 UniSTS
  85464 UniSTS
  8562 UniSTS
  8569 UniSTS
  8605 UniSTS
  8650 UniSTS
  8675 UniSTS
  8714 UniSTS
  87178 UniSTS
  8740 UniSTS
  8814 UniSTS
  89857 UniSTS
  89894 UniSTS
  90060 UniSTS
  9015 UniSTS
  9020 UniSTS
  90416 UniSTS
  90624 UniSTS
  9114 UniSTS
  9139 UniSTS
  9144 UniSTS
  91574 UniSTS
  917 UniSTS
  91775 UniSTS
  920 UniSTS
  9204 UniSTS
  92521 UniSTS
  92691 UniSTS
  9326 UniSTS
  94039 UniSTS
  94097 UniSTS
  9563 UniSTS
  9604 UniSTS
  9711 UniSTS
  9770 UniSTS
  9924 UniSTS
  9940 UniSTS
UniSTS 149621 UniSTS