AU049846 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU049846

Symbol: AU049846
Previously known as:
RGD ID: 5090595
Expected Size: 180 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.246,970,875 - 6,971,055 (-)MAPPERmRatBN7.2
Rnor_6.04710,651 - 710,830NCBIRnor6.0
Rnor_5.04703,533 - 703,712UniSTSRnor5.0
RGSC_v3.442,217,365 - 2,217,544UniSTSRGSC3.4
Celera43,308,650 - 3,308,829UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGTGCACACCATGTAAGCTCA
Reverse Primer GTCAGCAAGCTCCAGGCT
 

Region



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61351Bp33Blood pressure QTL 330.0018arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4127716890Rat
61408Scl23Serum cholesterol level QTL 230.0005blood HDL phospholipid amount (VT:0010504)serum high density lipoprotein phospholipid level (CMO:0001567)4127716890Rat
724557Plsm1Polydactyly-luxate syndrome (PLS) morphotypes QTL 10.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)4127716890Rat
1641905Colcr1Colorectal carcinoma resistance QTL 14.30.0003intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)4129494328Rat
61333Gluco16Glucose level QTL 164.30.00001adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)4130372989Rat
9589097Slep11Serum leptin concentration QTL 115.090.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)4131934116Rat
8552903Pigfal2Plasma insulin-like growth factor 1 level QTL 27.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4131934116Rat
9589046Scfw2Subcutaneous fat weight QTL 25.540.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)4131934116Rat
9590100Sffal4Serum free fatty acids level QTL 47.360.05blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)4131934116Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4132584199Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4133250345Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4133250345Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)4139505420Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)421079645210796Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
1358201Gluco12Glucose level QTL121.6adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake (CMO:0000870)4521839229593287Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat


Additional Information

Database Acc Id Source(s)
UniSTS 146292 UniSTS