AU049752 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU049752

Symbol: AU049752
Also known as:
RGD ID: 5090441
Expected Size: 268 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2168,263,357 - 8,263,625 (+)MAPPERmRatBN7.2
mRatBN7.21234,560,676 - 234,560,723 (+)MAPPERmRatBN7.2
Rnor_6.0169,244,838 - 9,245,105NCBIRnor6.0
Rnor_6.0169,244,838 - 9,245,189NCBIRnor6.0
Rnor_5.01611,205,231 - 11,205,582UniSTSRnor5.0
Rnor_5.01611,205,231 - 11,205,498UniSTSRnor5.0
RGSC_v3.4168,540,253 - 8,540,520UniSTSRGSC3.4
Celera166,942,338 - 6,942,651UniSTS
Cytogenetic Map16p16UniSTS
Is Marker For: Genes:   Lrrc18   Wdfy4  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAAGGGCGGGCATATGTG
Reverse Primer AGAGACAGAGACACACAGAGAGAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1311738Lrrc18leucine rich repeat containing 181682535248277439Rat
1564142Wdfy4WDFY family member 41682218538450494Rat

Nucleotide Sequences
GenBank Nucleotide AU049752 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1213533809243914901Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1225126575260522016Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
61455Niddm7Non-insulin dependent diabetes mellitus QTL 75.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1214537555238757011Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
724533Rf51Renal function QTL 515.30.0002kidney plasma flow trait (VT:0005524)renal plasma flow (CMO:0001914)1218753816256448513Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1224054293260122809Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1224569538260122809Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
631669Iddm9Insulin dependent diabetes mellitus QTL 92.80.039blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1233190394258625266Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
1581544Rf52Renal function QTL 520.05total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1232156370259647894Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1233948574260522016Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1197697768238755659Rat
1598821Rf55Renal function QTL 556.3renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1218748008257976495Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
2293700Bmd27Bone mineral density QTL 276.60.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1224054293243747962Rat
2293701Bmd34Bone mineral density QTL 348.30.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)1224054293243747962Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1224054293260122809Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1223201027260522016Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1578778Pur4Proteinuria QTL 43.30.003total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1228581588259647894Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
2316896Gluco57Glucose level QTL 577.2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1228985440245907899Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210702053240947965Rat
1358292Cm37Cardiac mass QTL 376.20.00000081heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
61400Niddm1Non-insulin dependent diabetes mellitus QTL 111blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1218753689245907899Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1191033875236033875Rat
1357403Slep4Serum leptin concentration QTL 43.91blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1619639137Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8hepatic copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
2301406Kidm39Kidney mass QTL 390.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)16285170915884239Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
737825Alc13Alcohol consumption QTL 134.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760916039848Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
61372Bp40Blood pressure QTL 402.2blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)16422773017696785Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306278 UniSTS
  498582 UniSTS
UniSTS 146198 UniSTS