UniSTS:143722 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:143722

Symbol: UniSTS:143722
Also known as: Kpna2; 
RGD ID: 5087983
Expected Size: 0 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22125,886,718 - 125,886,898 (+)MAPPER
mRatBN7.2530,455,902 - 30,456,083 (+)MAPPER
Rnor_6.0530,721,765 - 30,721,945NCBIRnor6.0
Rnor_6.02133,882,140 - 133,882,319NCBIRnor6.0
Rnor_5.0535,395,672 - 35,395,852UniSTSRnor5.0
Rnor_5.02153,375,666 - 153,375,845UniSTSRnor5.0
RGSC_v3.42129,907,965 - 129,908,144UniSTSRGSC3.4
RGSC_v3.4531,500,999 - 31,501,179UniSTSRGSC3.4
Celera529,629,047 - 29,629,227UniSTS
Celera2123,401,233 - 123,401,412UniSTS
Cytogenetic Map5q13UniSTS
Cytogenetic Map2q26UniSTS
Is Marker For: Genes:   RGD1560431   RGD1563847   LOC100362007  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCTGTGCTATTCTGTGTTCTC
Reverse Primer ACATGACAGGGTACGAAATTCC
 

Region



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5189432042Rat
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5193273395Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51136640934Rat
2312562Pur18Proteinuria QTL 182.60.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)5152509833001026Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)5152509878720537Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5166658771552720Rat
1300117Hrtrt8Heart rate QTL 83.49heart pumping trait (VT:2000009)heart rate (CMO:0000002)5325132948722188Rat
61462Niddm10Non-insulin dependent diabetes mellitus QTL 103.90.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)5452573847978104Rat
2293666Bmd38Bone mineral density QTL 384.4femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)5863228553632285Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)59514842103580403Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512651967117554267Rat
1641903Alcrsp3Alcohol response QTL 3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)51328888858288888Rat
1600358Mamtr5Mammary tumor resistance QTL 5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)51884791363847913Rat
1358353Srcrtb2Stress Responsive Cort Basal QTL 23.480.003blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)51884791376608178Rat
8552954Pigfal14Plasma insulin-like growth factor 1 level QTL 149blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)52190436366904363Rat
1549901Neudeg2Neurodegradation QTL 240nervous system integrity trait (VT:0010566)mononuclear cell count (CMO:0002119)52495621244747071Rat
1578767Stresp17Stress response QTL 174.30.01blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)52907889974078899Rat
1578776Stresp18Stress response QTL 182.9thymus mass (VT:0004954)thymus wet weight (CMO:0000855)52907889974078899Rat
6903292Stl28Serum triglyceride level QTL 282.60.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)52964166174641661Rat
6903306Scl35Serum cholesterol QTL 352.60.0073blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)52964166174641661Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242776916169852800Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242776916195645082Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)260325352147522851Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)278321410158159410Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246537589217498710Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243133606217498545Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243133606217498545Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256244671217498710Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242776916217498710Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266828049217498710Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242776916217498710Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2108880910153880910Rat
1582257Gluco21Glucose level QTL 213.10.0035blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2121750419169852800Rat
1581552Pur12Proteinuria QTL 125.190.0009total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)2115721880154182196Rat
2317886Alcrsp23Alcohol response QTL 232.40.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)296844330141844330Rat
738007Anxrr7Anxiety related response QTL 74.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2123456539168456539Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2116075644228737869Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)223837491149614623Rat
1581578Cm49Cardiac mass QTL 494.90.01heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)268866454149614466Rat
1598862Glom9Glomerulus QTL 93.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)295946719140946719Rat
1598863Cm65Cardiac mass QTL 652.3heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)295946719140946719Rat
2300165Bmd49Bone mineral density QTL 494.80.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)291664872136664872Rat
2300170Bmd45Bone mineral density QTL 4512.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)291664872136664872Rat
2300185Bmd46Bone mineral density QTL 468.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)291664872136664872Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243141290154583160Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2116075644228737869Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2118446646227707979Rat
1354594Despr10Despair related QTL 100.00000249locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)2119789823164789823Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243149788198704485Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226186097135654963Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)275687495221880419Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)283819608239166203Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266828236243550655Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)283819608243901375Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)280631950149614623Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)260131410135646395Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)293995316169852800Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2118446793228582621Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226186097142053534Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)223837719169852670Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)268865414169852800Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491169852800Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491169852800Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)223837719169852670Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491218957222Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491218957222Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2118446646200453484Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2118446646200453484Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2118446646149614623Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2118446646149614623Rat
1358360Sradr2Stress Responsive Adrenal Weight QTL 210.24adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)2133399373173020198Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)278321410217498710Rat
5135226Leukc2Leukocyte quantity QTL 2eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)2121750419155965721Rat
7207808Bmd89Bone mineral density QTL 894.1femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)291664872136664872Rat
9589093Slep10Serum leptin concentration QTL 103.840.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)2102356980147356980Rat
8662836Vetf8Vascular elastic tissue fragility QTL 80.66thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2110965721155965721Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)283754907237610852Rat
12879843Am3Aortic mass QTL 30.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)227161361148295267Rat
12879841Cm87Cardiac mass QTL 870.026heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)227161361148295267Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)216679272245624402Rat
12879844Kidm62Kidney mass QTL 620.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)227161361148295267Rat
12879842Cm88Cardiac mass QTL 880.042heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)227161361148295267Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100362007 UniSTS
  310383 UniSTS
  366323 UniSTS
UniSTS 143722 UniSTS