AA799570 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AA799570

Symbol: AA799570
Also known as:
RGD ID: 5085183
Expected Size: 148 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0859,294,183 - 59,294,330NCBIRnor6.0
Rnor_6.0129,706,112 - 29,706,259NCBIRnor6.0
Rnor_5.0857,875,235 - 57,875,382UniSTSRnor5.0
Rnor_5.0131,140,954 - 31,141,101UniSTSRnor5.0
RGSC_v3.4858,266,714 - 58,266,861UniSTSRGSC3.4
RGSC_v3.4128,059,551 - 28,059,698UniSTSRGSC3.4
Celera126,005,927 - 26,006,074UniSTS
Celera854,588,953 - 54,589,100UniSTS
RH 3.4 Map8611.5UniSTS
Cytogenetic Map1p11UniSTS
Cytogenetic Map8q24UniSTS
Is Marker For: Genes:   Dnaja4   LOC498996  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGGGGAACACAGATTAGAGAAGG
Reverse Primer GGAGATGCCAGTACCACACTAAC
 

Region



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2313053Bss51Bone structure and strength QTL 513.80.0001tibia length (VT:0004357)tibia length (CMO:0000450)1134993530Rat
2313070Bss52Bone structure and strength QTL 524.40.0001body length (VT:0001256)body length (CMO:0000013)1134993530Rat
2313090Bmd69Bone mineral density QTL 694.40.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)1134993530Rat
738020Pia8Pristane induced arthritis QTL 84.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1164407321Rat
1578650Bmd6Bone mineral density QTL 612.2femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)125439343579402Rat
1578651Bmd7Bone mineral density QTL 714.2femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)125439343579402Rat
1578669Bss9Bone structure and strength QTL 96.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)125439343579402Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)125439386904217Rat
1600360Mcs16Mammary carcinoma susceptibility QTL 162.4mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1186804543724576Rat
7421626Bp360Blood pressure QTL 3600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1457869349578693Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15655769122614963Rat
4889451Eae29Experimental allergic encephalomyelitis QTL 295.51nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1565577285706974Rat
1300167Hrtrt2Heart rate QTL 24.35heart pumping trait (VT:2000009)heart rate (CMO:0000002)11131448975844121Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)11131448983657083Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11131448983657083Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11131448983657083Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11131448983657083Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11131448983657083Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11131448983657083Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11131448983657083Rat
2317755Glom22Glomerulus QTL 223.8urine protein amount (VT:0005160)urine protein level (CMO:0000591)11131465834993348Rat
631508Sald1Serum aldosterone level QTL 13.7blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)11249343957493439Rat
2302038Pia31Pristane induced arthritis QTL 315.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)11362925158629251Rat
5684998Bss101Bone structure and strength QTL 1013.6tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)11614314349547474Rat
5684999Bss102Bone structure and strength QTL 1025.50.00000072tibia strength trait (VT:1000284)tibia stiffness (CMO:0001735)11614314349547474Rat
634353Rends2Renal damage susceptibility QTL 20.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)12034156058000154Rat
724520Bp145Blood pressure QTL 1452.10.0024arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12107930566079305Rat
631494Bp95Blood pressure QTL 95400.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12130082249454378Rat
1558642Prcr2Prostate cancer resistance QTL 24.3prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)12181262344409802Rat
1357397Bw41Body weight QTL 414.190.0001body mass (VT:0001259)body weight (CMO:0000012)12340642849547474Rat
1357401Bw43Body weight QTL 433.75body mass (VT:0001259)body weight (CMO:0000012)12340642849547474Rat
1357400Bw62Body weight QTL624.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)12340642868406428Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)123406428108057505Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)12429779978748000Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)125951907130917265Rat
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)89531047119211942Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810938911120496129Rat
1558646Swd5Spike wave discharge measurement QTL 53.450.00036brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)81766655562666555Rat
61373Mcs4Mammary carcinoma susceptibility QTL 41.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)82071759265717592Rat
631271Lecl1Lens clarity QTL 10.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)82146491991140553Rat
731182Uae24Urinary albumin excretion QTL 246.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)821813070100873963Rat
631842Inf1Infertility severity QTL 14.10.001seminal gland mass (VT:0010524)seminal vesicle wet weight (CMO:0001603)82784149672841496Rat
631648Stl5Serum triglyceride level QTL 540.0003blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)82986798359908353Rat
1358892Kidm26Kidney mass QTL 263.69kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)829867983106526740Rat
1358896Bp262Blood pressure QTL 2622.89arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)829867983106526740Rat
1358907Cm40Cardiac mass QTL 401.89heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)829867983106526740Rat
2303564Gluco43Glucose level QTL 433blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)83014480075144800Rat
2303572Insul13Insulin level QTL 132blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)83014480075144800Rat
1300146Rf17Renal function QTL 172.9renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)83091811275918112Rat
8662823Vetf5Vascular elastic tissue fragility QTL 51.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)830918112107206309Rat
724514Uae15Urinary albumin excretion QTL 152.9urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)83220198175971421Rat
1549908Neudeg1Neurodegradation QTL 15.50nervous system integrity trait (VT:0010566)logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986)832888352101374135Rat
1331744Bp217Blood pressure QTL 2173.398arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83355866062857995Rat
61353Bp35Blood pressure QTL 350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83355866065717592Rat
61353Bp35Blood pressure QTL 350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83355866065717592Rat
61353Bp35Blood pressure QTL 350.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)83355866065717592Rat
61353Bp35Blood pressure QTL 350.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)83355866065717592Rat
1359033Bp273Blood pressure QTL 273arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83355866065717592Rat
11556286Cm81Cardiac mass QTL 810.01heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)83355866065717592Rat
2313046Bss78Bone structure and strength QTL 783.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)83355866089058369Rat
2313057Bss76Bone structure and strength QTL 7630.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)83355866089058369Rat
2313067Bss77Bone structure and strength QTL 773.10.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)83355866089058369Rat
2313088Bss75Bone structure and strength QTL 753.10.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)83355866089058369Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)833558660109028082Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)833558660109028082Rat
1578755Pur5Proteinuria QTL 53.30.0001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)833558660109028082Rat
2316950Scl66Serum cholesterol level QTL 664.1blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)833558764113580387Rat
1298065Scl16Serum cholesterol level QTL 163.8blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)83504141480041414Rat
1582222Epfw2Epididymal fat weight QTL 23.20.0005epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)83592559480925594Rat
1331838Niddm61Non-insulin dependent diabetes mellitus QTL 613.530.0004blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)839230130106506973Rat
61358Bp39Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83992790184927901Rat
61464Niddm11Non-insulin dependent diabetes mellitus QTL 113.10.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83995802284958022Rat
737824Hcar10Hepatocarcinoma resistance QTL 102.9liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)84421919789542960Rat
1358906Bp253Blood pressure QTL 25340.0004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)844219197100873963Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)844458129118087517Rat
1331769Rf39Renal function QTL 393.871urine output (VT:0003620)timed urine volume (CMO:0000260)84571234480003418Rat
1298079Activ2Activity QTL 29.50.000001voluntary movement trait (VT:0003491)rearing measurement (CMO:0001515)84571234490712344Rat
631216Stl9Serum triglyceride level QTL 94.710.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)84571247575971259Rat
70161Bp62Blood pressure QTL 622.90.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84658843796998640Rat
12879882Am8Aortic mass QTL 80.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)847200750106394378Rat
12879878Bw183Body weight QTL 1830.001body mass (VT:0001259)body weight (CMO:0000012)847200750106394378Rat
12879879Cm99Cardiac mass QTL 990.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)847200750106394378Rat
12879880Cm100Cardiac mass QTL 1000.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)847200750106394378Rat
12879881Cm101Cardiac mass QTL 1010.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)847200750106394378Rat
12879883Kidm65Kidney mass QTL 650.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)847200750106394378Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)850529480128036471Rat
1331837Bw23Body weight QTL 234.190.00007body mass (VT:0001259)body weight (CMO:0000012)850529563106506973Rat
2313086Bss60Bone structure and strength QTL 604.10.0001tibia length (VT:0004357)tibia length (CMO:0000450)85406504489058369Rat
4889938Bss89Bone structure and strength QTL 893.8tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)85406504489058369Rat
5684973Bss100Bone structure and strength QTL 1004.7tibia area (VT:1000281)tibia area measurement (CMO:0001382)85406504489058369Rat
1358912Bw51Body weight QTL 512.95body mass (VT:0001259)body weight (CMO:0000012)855435004115812386Rat
2303570Gluco48Glucose level QTL 482blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)855659105100659105Rat
2293697Bmd39Bone mineral density QTL 39femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)858230766106394378Rat
1582243Bw66Body weight QTL 663.40.0048body mass (VT:0001259)body weight (CMO:0000012)85842551091990535Rat
1582254Kidm31Kidney mass QTL 313kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)85842551091990535Rat
631664Hcar3Hepatocarcinoma resistance QTL 32.90.0005liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)858425510106526740Rat
1300150Cm3Cardiac mass QTL 33.97heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)85842567959716199Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)859234112108068306Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 300721 UniSTS
  498996 UniSTS
UniSTS 260560 UniSTS