AI228530 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AI228530

Symbol: AI228530
Also known as:
RGD ID: 5084746
Expected Size: 249 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.010107,631,211 - 107,631,463NCBIRnor6.0
Rnor_6.01827,134,422 - 27,134,671NCBIRnor6.0
Rnor_5.01826,847,961 - 26,848,210UniSTSRnor5.0
Rnor_5.010107,265,698 - 107,265,950UniSTSRnor5.0
RGSC_v3.41826,819,849 - 26,820,098UniSTSRGSC3.4
RGSC_v3.410108,608,479 - 108,608,731UniSTSRGSC3.4
Celera10102,395,754 - 102,396,006UniSTS
Celera1825,692,430 - 25,692,679UniSTS
RH 3.4 Map18346.4UniSTS
Cytogenetic Map18p12UniSTS
Cytogenetic Map10q32.3UniSTS
Is Marker For: Genes:   Reep5   Srp19   Rbfox3   LOC100365559   LOC100359568   LOC100363156  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACGTTCGCAGCTCAGTTAAACA
Reverse Primer AGTTCCCATCACGTAAGTCGGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306047Reep5receptor accessory protein 5182712846227159693Rat
7637519LOC102549915signal recognition particle 19 kDa protein-like182713325127134972Rat
1560070Rbfox3RNA binding fox-1 homolog 310107517916107850764Rat
2324734LOC100363156signal recognition particle 19kDa-like10107630518107632293Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135097280Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18138195967Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18138195967Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18138753381Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18371954732487870Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18440751362570466Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18543013441781619Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181467885259678852Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181553296332704022Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181553296332704022Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181553942732670473Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181553942753861431Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181553942761499684Rat
2301410Bp317Blood pressure QTL 3170.004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181553955127743236Rat
12904690Cm129Cardiac mass QTL 1290.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)181553955127743236Rat
12904689Cm128Cardiac mass QTL 1280.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)181553955127743236Rat
12904693Am20Aortic mass QTL 200.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)181553955127743236Rat
12904695Kidm73Kidney mass QTL 730.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)181553955127743236Rat
12904691Cm130Cardiac mass QTL 1300.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)181553955127743236Rat
12904680Bw189Body weight QTL 1890.019body mass (VT:0001259)body weight (CMO:0000012)181553955127743236Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181553967129530300Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181553967161985648Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181569587268524999Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181569587287080053Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181569587287080053Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181903103068436105Rat
1331775Bp235Blood pressure QTL 2353.201arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181925171732670473Rat
1331735Rf44Renal function QTL 442.981total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)181925171732670473Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)182028575887080053Rat
7387267Uae42Urinary albumin excretion QTL 420.61urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)142163949166639491Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182260373687074531Rat
6903353Bp353Blood pressure QTL 3532.8arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182260476461985648Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)182318422753861431Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182596102681761656Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182674340443659626Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109841807108540162Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014827894107857673Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014827894110992275Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1023861015112626471Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1043289657108540162Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1053621375112626471Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1053621375112626471Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1055678976112626471Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1065590122110590122Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1065992275110992275Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1065992275110992275Rat
7387312Bw125Body weight QTL 12530.0047retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight (CMO:0000356)1067880046112626471Rat
1581559Eae18Experimental allergic encephalomyelitis QTL 180.00002nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1067988218110992091Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1069385595112626471Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1069385595112626471Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1070166960112626471Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1070800069112626471Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1071692298112626471Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1073008136112626471Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1073008136112626471Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1073008136112626471Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1073467158112626471Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1075544754112626471Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1075544754112626471Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1078970279112626471Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1079927661112626471Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1080239190112626471Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1085079943112626471Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1086566908112626471Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1090041957112626471Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1090296897112626471Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1091689348112626471Rat
1579915Bp280Blood pressure QTL 2800.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1093662786112626471Rat
12880395Cm109Cardiac mass QTL 1090.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1093662786112626471Rat
12880396Am13Aortic mass QTL 130.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1093662786112626471Rat
12880398Kidm67Kidney mass QTL 670.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1093662786112626471Rat
12880384Cm107Cardiac mass QTL 1070.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)93662786112626471Rat
12880385Cm108Cardiac mass QTL 1080.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)93662786112626471Rat
1300137Bp186Blood pressure QTL 1863.57arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1093886117110992275Rat
724530Bp149Blood pressure QTL 1490.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1093886117112626471Rat
1558652Bw57Body weight QTL 574.20.0008body mass (VT:0001259)body weight (CMO:0000012)1094170766112626471Rat
61436Cia5Collagen induced arthritis QTL 54.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1094486204107857673Rat
1354641Bvd2Brain ventricular dilatation QTL 26.360.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)1096520816110992275Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1098079221112626471Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1098079221112626471Rat
1576307Cia28Collagen induced arthritis QTL 28joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1099492217107857673Rat
1576313Pia25Pristane induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1099492217107857673Rat
1578663Bss18Bone structure and strength QTL 183.6femur width (VT:1000666)femoral neck width (CMO:0001695)10100155035110992275Rat
1578672Bmd16Bone mineral density QTL 166.2femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)10100155035110992275Rat
631539Oia6Oil induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10100460820108540162Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100359568 UniSTS
  100363156 UniSTS
  100365559 UniSTS
  287847 UniSTS
  291685 UniSTS
  364838 UniSTS
UniSTS 250520 UniSTS